Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T67849 | Target Info | |||
Target Name | PI3-kinase delta (PIK3CD) | ||||
Synonyms | PtdIns-3-kinase subunit p110-delta; PtdIns-3-kinase subunit delta; Phosphoinositide 3-kinase delta; Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit, delta isoform; Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform; Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit delta; PI3Kdelta; PI3K-delta; PI3-kinase subunit delta; PI3-kinase p110 subunit delta; P110delta | ||||
Target Type | Successful Target | ||||
Gene Name | PIK3CD | ||||
Biochemical Class | Kinase | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-30a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uguaaacauccucgacuggaag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | PIK3CD is a direct target of miR-30a. | [1] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [1] | |||
Representative Target(s) Regulated by This miRNA | Beclin-1 (BECN1) | Target Info | |||
Brain-derived neurotrophic factor (BDNF) | Target Info | ||||
miRNA Mature ID | hsa-miR-663a | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aggcggggcgccgcgggaccgc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | PIK3CD, a direct target of miR-663, is downregulated by miR-663 overexpression. | [2] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [2] | |||
Representative Target(s) Regulated by This miRNA | C-X-C chemokine receptor type 4 (CXCR4) | Target Info | |||
CCAAT/enhancer binding protein beta (CEBPB) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | miR-30a suppresses cell migration and invasion through downregulation of PIK3CD in colorectal carcinoma. Cell Physiol Biochem. 2013;31(2-3):209-18. | ||||
REF 2 | Primate-specific miR-663 functions as a tumor suppressor by targeting PIK3CD and predicts the prognosis of human glioblastoma. Clin Cancer Res. 2014 Apr 1;20(7):1803-13. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.