Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T67894 Target Info
Target Name Toll-like receptor 3 (TLR3)
Synonyms CD283
Target Type Clinical trial Target
Gene Name TLR3
Biochemical Class Toll-like receptor
UniProt ID
O15455
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism Significant downregulation of luciferase activity was found following cotransfection with miR-21-3p mimic. [2]
Evidence Score (E-score) 2 +
1 ELISA [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-758-3p miRNA Info
miRNA Mature AC
MIMAT0003879
Sequence uuugugaccugguccacuaacc
miRNA Species Homo sapiens
Regulation Mechanism miR-758 significantly suppressed the expression of luciferase reporter genes fused to the 3' UTR regions of TLR3 and this could be reversed by further introduction of miR-758 inhibitor into QSG-7701 cells which demonstrating that miR-758 can supress TLR3 expression through binding to its 3 UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Toll-like receptor 3 (TLR3) Target Info
TLR3_HUMAN
References  Top
REF 1 Activation of TLR3 and its adaptor TICAM-1 increases miR-21 levels in extracellular vesicles released from human cells. Biochem Biophys Res Commun. 2018 Jun 7;500(3):744-750.
REF 2 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 3 Hepatitis C virus infection decreases the expression of Toll-like receptors 3 and 7 via upregulation of miR-758. Arch Virol. 2014 Nov;159(11):2997-3003.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.