Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T69200 | Target Info | |||
Target Name | Mitotic growth and transcription activator (BAF190A) | ||||
Synonyms | Transcription activator BRG1; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4; SNF2L4; SNF2B; SNF2-beta; Protein brahma homolog 1; Protein BRG-1; BRG1-associated factor 190A; BRG1; ATP-dependent helicase SMARCA4 | ||||
Target Type | Literature-reported Target | ||||
Gene Name | SMARCA4 | ||||
Biochemical Class | Acid anhydride hydrolase | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuaaugcuaaucgugauagggguu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
miRNA Mature ID | hsa-miR-139-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucuacagugcacgugucuccagu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
C-X-C chemokine receptor type 4 (CXCR4) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | SMARCA4 is a direct target of miR-21. | [4] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | BRG1 regulation by miR-155 in human leukemia and lymphoma cell lines. Clin Transl Oncol. 2017 Aug;19(8):1010-1017. | ||||
REF 2 | Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22. | ||||
REF 3 | MicroRNA-139-5p regulates proliferation of hematopoietic progenitors and is repressed during BCR-ABL-mediated leukemogenesis. Blood. 2016 Oct 27;128(17):2117-2129. | ||||
REF 4 | MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011 Jun 30;30(26):2975-85. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.