Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T71367 | Target Info | |||
Target Name | MEK kinase kinase 4 (MAP4K4) | ||||
Synonyms | Nckinteracting kinase; Nck-interacting kinase; Mitogenactivated protein kinase kinase kinase kinase 4; Mitogen-activated protein kinase kinase kinase kinase 4; MEKKK 4; MAPK/ERK kinase kinase kinase 4; KIAA0687; HPK/GCKlike kinase HGK; HPK/GCK-like kinase HGK; HGK | ||||
Target Type | Patented-recorded Target | ||||
Gene Name | MAP4K4 | ||||
Biochemical Class | Kinase | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-141-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaacacugucugguaaagaugg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miRNA-141 inhibits cell proliferation and invasion by directly targeting MAP4K4. | [1] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [1] | |||
2 | Western Blot; qPCR; Immunohistochemistry | [2] | |||
Representative Target(s) Regulated by This miRNA | Activin receptor type IIB (ACVR2B) | Target Info | |||
Bromodomain-containing protein 3 (BRD3) | Target Info | ||||
miRNA Mature ID | hsa-miR-30d-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uguaaacauccccgacuggaag | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [3] | |||
2 | qRT-PCR; Western Blot | [4] | |||
Representative Target(s) Regulated by This miRNA | Autophagy-related 2B (ATG2B) | Target Info | |||
Beclin-1 (BECN1) | Target Info | ||||
miRNA Mature ID | hsa-miR-31-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aggcaagaugcuggcauagcu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-31 targets melanoma oncogenes NIK. | [5] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Immunoblot; Immunohistochemistry; Luciferase Reporter Assay | [5] | |||
Representative Target(s) Regulated by This miRNA | Cyclin-dependent kinase 1 (CDK1) | Target Info | |||
Dickkopf-related protein 1 (DKK1) | Target Info | ||||
miRNA Mature ID | hsa-miR-302c-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuuaacauggggguaccugcug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-302 mimics suppress MAP4K4 3'UTR luciferase activity, MAP4K4 3'UTR activity was upregulated following miR-302c silencing. | [6] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [6] | |||
Representative Target(s) Regulated by This miRNA | MEK kinase kinase 4 (MAP4K4) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | miRNA-141, downregulated in pancreatic cancer, inhibits cell proliferation and invasion by directly targeting MAP4K4. Mol Cancer Ther. 2013 Nov;12(11):2569-80. | ||||
REF 2 | Chemotherapy-induced miR-141/MAP4K4 signaling suppresses progression of colorectal cancer. Biosci Rep. 2018 Dec 21;38(6). pii: BSR20180978. | ||||
REF 3 | MicroRNA-30d induces insulin transcription factor MafA and insulin production by targeting mitogen-activated protein 4 kinase 4 (MAP4K4) in pancrea... J Biol Chem. 2012 Sep 7;287(37):31155-64. | ||||
REF 4 | Circulating MicroRNA-30d Is Associated With Response to Cardiac Resynchronization Therapy in Heart Failure and Regulates Cardiomyocyte Apoptosis: A Translational Pilot Study. Circulation. 2015 Jun 23;131(25):2202-2216. | ||||
REF 5 | Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25. | ||||
REF 6 | Mir-302c mediates influenza A virus-induced IFN expression by targeting NF-B inducing kinase. FEBS Lett. 2015 Dec 21;589(24 Pt B):4112-8. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.