The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-141-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaacacugucugguaaagaugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miRNA-141 inhibits cell proliferation and invasion by directly targeting MAP4K4. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot; qPCR; Immunohistochemistry |
[2] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Bromodomain-containing protein 3 (BRD3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30d-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccccgacuggaag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
2 |
qRT-PCR; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Autophagy-related 2B (ATG2B)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-31-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaagaugcuggcauagcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-31 targets melanoma oncogenes NIK. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunoblot; Immunohistochemistry; Luciferase Reporter Assay |
[5] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 1 (CDK1)
|
Target Info
|
|
Dickkopf-related protein 1 (DKK1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-302c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuaacauggggguaccugcug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-302 mimics suppress MAP4K4 3'UTR luciferase activity, MAP4K4 3'UTR activity was upregulated following miR-302c silencing. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
MEK kinase kinase 4 (MAP4K4)
|
Target Info
|
|