Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T73180 Target Info
Target Name Matrix metalloproteinase-11 (MMP-11)
Synonyms Stromelysin-3 (ST3) gene; Stromelysin-3; STR-3; STMY3; ST3/MMP11; ST3; SL-3
Target Type Literature-reported Target
Gene Name MMP11
Biochemical Class Peptidase
UniProt ID
P24347
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a directly downregulated the MMP11. [1]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Report Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-139-5p binds on 3'UTR of MMP11. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-139-3p miRNA Info
miRNA Mature AC
MIMAT0004552
Sequence uggagacgcggcccuguuggagu
miRNA Species Homo sapiens
Regulation Mechanism miR-139-3p binds on 3'UTR of MMP11. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
Matrix metalloproteinase-11 (MMP-11) Target Info
MMP11_HUMAN
References  Top
REF 1 Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF. PLoS One. 2012;7(6):e40169.
REF 2 Diverse functions of miR-125 family in different cell contexts. J Hematol Oncol. 2013 Jan 15;6:6.
REF 3 Dual tumor-suppressors miR-139-5p and miR-139-3p targeting matrix metalloprotease 11 in bladder cancer. Cancer Sci. 2016 Sep;107(9):1233-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.