miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-125a-5p | ||||
miRNA Stemloop AC | MI0000469 | ||||
miRNA Stemloop ID | hsa-mir-125a | ||||
Sequence | ucccugagacccuuuaaccuguga | ||||
TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [2] | ||
Janus kinase 2 (JAK-2) | Successful Target | Target Info | [3] | ||
Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [4] | ||
NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [5] | ||
PI3-kinase gamma (PIK3CG) | Successful Target | Target Info | [4] | ||
Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [6] | ||
Estrogen-related receptor-alpha (ESRRA) | Successful Target | Target Info | [7] | ||
Interferon-gamma (IFNG) | Successful Target | Target Info | [8] | ||
Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [9] | ||
Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [10] | ||
RAC-alpha serine/threonine-protein kinase (AKT1) | Clinical trial Target | Target Info | [4] | ||
Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [11] | ||
Retinoic acid receptor alpha (RARA) | Clinical trial Target | Target Info | [12] | ||
Stress-activated protein kinase 2a (p38 alpha) | Clinical trial Target | Target Info | [13] | ||
Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [14] | ||
Erbb3 tyrosine kinase receptor (Erbb-3) | Clinical trial Target | Target Info | [2] | ||
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [6] | ||
Proto-oncogene c-RAF (c-RAF) | Clinical trial Target | Target Info | [15] | ||
Leukemia inhibitory factor receptor (LIFR) | Clinical trial Target | Target Info | [16] | ||
T-cell-specific protein RANTES (CCL5) | Clinical trial Target | Target Info | [17] | ||
Delta-like protein 4 (DLL4) | Clinical trial Target | Target Info | [18] | ||
Hematopoietic progenitor cell antigen CD34 (CD34) | Clinical trial Target | Target Info | [19] | ||
Histone deacetylase 5 (HDAC5) | Patented-recorded Target | Target Info | [20] | ||
Caspase-2 (CASP2) | Patented-recorded Target | Target Info | [21] | ||
Matrix metalloproteinase-11 (MMP-11) | Literature-reported Target | Target Info | [22] | ||
TNF receptor-associated factor 6 (TRAF6) | Literature-reported Target | Target Info | [23] | ||
Tyrosine-protein kinase ABL2 (ABL2) | Literature-reported Target | Target Info | [24] | ||
Zinc finger protein A20 (TNFAIP3) | Literature-reported Target | Target Info | [25] | ||
Apoptosis regulator BAK (BAK) | Literature-reported Target | Target Info | [26] | ||
Endothelin-1 (EDN1) | Literature-reported Target | Target Info | [27] | ||
ELAV-like protein 1 (ELAVL1) | Literature-reported Target | Target Info | [28] | ||
Eukaryotic translation initiation factor 4E-binding protein 1 (EIF4EBP1) | Literature-reported Target | Target Info | [29] | ||
Leukemia inhibitory factor (LIF) | Clinical trial Target | Target Info | [30] | ||
Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [31] | ||
HCLS1-associated protein X-1 (HAX1) | Literature-reported Target | Target Info | [32] | ||
Protein(s) Regulated by This miRNA | AT-rich interactive domain-containing protein 3A | Regulated Protein | [33] | ||
AT-rich interactive domain-containing protein 3B | Regulated Protein | [34] | |||
Bcl-2-like protein 12 | Regulated Protein | [6] | |||
Beta-1,3-N-acetylglucosaminyltransferase lunatic fringe | Regulated Protein | [36] | |||
Beta-1,4-galactosyltransferase 1 | Regulated Protein | [37] | |||
C-type lectin domain family 5 member A | Regulated Protein | [38] | |||
Dedicator of cytokinesis protein 3 | Regulated Protein | [37] | |||
Disintegrin and metalloproteinase domain-containing protein 9 | Regulated Protein | [39] | |||
Ethanolamine kinase 2 | Regulated Protein | [37] | |||
Grainyhead-like protein 1 homolog | Regulated Protein | [37] | |||
GTP-binding protein Rit1 | Regulated Protein | [37] | |||
Hexokinase-2 | Regulated Protein | [40] | |||
Interleukin-1 receptor antagonist protein | Regulated Protein | [37] | |||
Krueppel-like factor 13 | Regulated Protein | [17] | |||
Krueppel-like factor 13 | Regulated Protein | [42] | |||
Mannan-binding lectin serine protease 1 | Regulated Protein | [39] | |||
Microtubule-associated tumor suppressor 1 | Regulated Protein | [12] | |||
Mothers against decapentaplegic homolog 2 | Regulated Protein | [44] | |||
Mothers against decapentaplegic homolog 4 | Regulated Protein | [45] | |||
Multiple epidermal growth factor-like domains protein 9 | Regulated Protein | [37] | |||
NAD-dependent protein deacetylase sirtuin-7 | Regulated Protein | [46] | |||
Niban-like protein 1 | Regulated Protein | [37] | |||
Nuclear apoptosis-inducing factor 1 | Regulated Protein | [47] | |||
Polypeptide N-acetylgalactosaminyltransferase 14 | Regulated Protein | [48] | |||
PR domain zinc finger protein 1 | Regulated Protein | [37] | |||
Protein lin-28 homolog A | Regulated Protein | [49] | |||
Reticulon-2 | Regulated Protein | [39] | |||
Tafazzin | Regulated Protein | [50] | |||
Thyrotroph embryonic factor | Regulated Protein | [39] | |||
Ubiquitin-conjugating enzyme E2 L3 | Regulated Protein | [39] | |||
Vacuolar protein sorting-associated protein 51 homolog | Regulated Protein | [51] | |||
Zinc finger and BTB domain-containing protein 7A | Regulated Protein | [52] | |||
Zinc finger transcription factor Trps1 | Regulated Protein | [37] | |||
References | |||||
REF 1 | miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. Leuk Res. 2014 Mar;38(3):402-10. | ||||
REF 2 | Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86. | ||||
REF 3 | Expression analysis of microRNA-125 in patients with polycythemia vera and essential thrombocythemia and correlation with JAK2 allele burden and laboratory findings. Int J Lab Hematol. 2015 Oct;37(5):661-7. | ||||
REF 4 | miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686. | ||||
REF 5 | MicroRNA profiling in human medulloblastoma. Int J Cancer. 2009 Feb 1;124(3):568-77. | ||||
REF 6 | miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36. | ||||
REF 7 | MicroRNA-125a reduces proliferation and invasion of oral squamous cell carcinoma cells by targeting estrogen-related receptor : implications for cancer therapeutics. J Biol Chem. 2014 Nov 14;289(46):32276-90. | ||||
REF 8 | Dysregulation in microRNA expression is associated with alterations in immune functions in combat veterans with post-traumatic stress disorder. PLoS One. 2014 Apr 23;9(4):e94075. | ||||
REF 9 | MiR-125a suppresses tumor growth, invasion and metastasis in cervical cancer by targeting STAT3. Oncotarget. 2015 Sep 22;6(28):25266-80. | ||||
REF 10 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
REF 11 | miR-125a-5p is a prognostic biomarker that targets HDAC4 to suppress breast tumorigenesis. Oncotarget. 2015 Jan 1;6(1):494-509. | ||||
REF 12 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
REF 13 | Down-regulation of miR-125a-5p is associated with salivary adenoid cystic carcinoma progression via targeting p38/JNK/ERK signal pathway. Am J Transl Res. 2017 Mar 15;9(3):1101-1113. | ||||
REF 14 | MicroRNA 125a and its regulation of the p53 tumor suppressor gene. FEBS Lett. 2009 Nov 19;583(22):3725-30. | ||||
REF 15 | MicroRNA-125a-5p Is a Downstream Effector of Sorafenib in Its Antiproliferative Activity Toward Human Hepatocellular Carcinoma Cells. J Cell Physiol. 2017 Jul;232(7):1907-1913. | ||||
REF 16 | MicroRNA-125a influences breast cancer stem cells by targeting leukemia inhibitory factor receptor which regulates the Hippo signaling pathway. Oncotarget. 2015 Jul 10;6(19):17366-78. | ||||
REF 17 | MicroRNA-125a contributes to elevated inflammatory chemokine RANTES levels via targeting KLF13 in systemic lupus erythematosus. Arthritis Rheum. 2010 Nov;62(11):3425-35. | ||||
REF 18 | Exosomes secreted by mesenchymal stem cells promote endothelial cell angiogenesis by transferring miR-125a. J Cell Sci. 2016 Jun 1;129(11):2182-9. | ||||
REF 19 | Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50. | ||||
REF 20 | HDAC inhibitors target HDAC5, upregulate microRNA-125a-5p, and induce apoptosis in breast cancer cells. Mol Ther. 2015 Apr;23(4):656-66. | ||||
REF 21 | MiR-125a-5p decreases after long non-coding RNA HOTAIR knockdown to promote cancer cell apoptosis by releasing caspase 2. Cell Death Dis. 2016 Mar 10;7:e2137. | ||||
REF 22 | Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF. PLoS One. 2012;7(6):e40169. | ||||
REF 23 | MiR-125a TNF receptor-associated factor 6 to inhibit osteoclastogenesis. Exp Cell Res. 2014 Feb 15;321(2):142-52. | ||||
REF 24 | MicroRNA-125a-5p modulates human cervical carcinoma proliferation and migration by targeting ABL2. Drug Des Devel Ther. 2015 Dec 24;10:71-9. | ||||
REF 25 | MicroRNAs miR-125a and miR-125b constitutively activate the NF-B pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci U S A. 2012 May 15;109(20):7865-70. | ||||
REF 26 | MicroRNA miR-125a controls hematopoietic stem cell number. Proc Natl Acad Sci U S A. 2010 Aug 10;107(32):14229-34. | ||||
REF 27 | A Single-Nucleotide Polymorphism in 3'-Untranslated Region of Endothelin-1 Reduces Risk of Dementia After Ischemic Stroke. Med Sci Monit. 2016 Apr 23;22:1368-74. | ||||
REF 28 | MicroRNA-125a represses cell growth by targeting HuR in breast cancer. RNA Biol. 2009 Nov-Dec;6(5):575-83. | ||||
REF 29 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
REF 30 | Human multipotent stromal cells from bone marrow and microRNA: regulation of differentiation and leukemia inhibitory factor expression. Proc Natl Acad Sci U S A. 2008 Nov 25;105(47):18372-7. | ||||
REF 31 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
REF 32 | Inhibition of HAX-1 by miR-125a reverses cisplatin resistance in laryngeal cancer stem cells. Oncotarget. 2016 Dec 27;7(52):86446-86456. | ||||
REF 33 | ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45. | ||||
REF 34 | The epidermal growth factor receptor responsive miR-125a represses mesenchymal morphology in ovarian cancer cells.Neoplasia. 2009 Nov;11(11):1208-15. | ||||
REF 35 | miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36. | ||||
REF 36 | Mir-125a-5p-mediated regulation of Lfng is essential for the avian segmentation clock.Dev Cell. 2013 Mar 11;24(5):554-61. | ||||
REF 37 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 38 | Myelodysplastic syndromes are induced by histone methylationltering ASXL1 mutations.J Clin Invest. 2013 Nov;123(11):4627-40. | ||||
REF 39 | Adaptive expression of microRNA-125a in adipose tissue in response to obesity in mice and men.PLoS One. 2014 Mar 27;9(3):e91375. | ||||
REF 40 | MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene.J Biol Chem. 2012 Jun 29;287(27):23227-35. | ||||
REF 41 | MicroRNA-125a contributes to elevated inflammatory chemokine RANTES levels via targeting KLF13 in systemic lupus erythematosus. Arthritis Rheum. 2010 Nov;62(11):3425-35. | ||||
REF 42 | miR-125a-5p regulates differential activation of macrophages and inflammation.J Biol Chem. 2013 Dec 6;288(49):35428-36. | ||||
REF 43 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
REF 44 | Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439. | ||||
REF 45 | miR-125 potentiates early neural specification of human embryonic stem cells.Development. 2012 Apr;139(7):1247-57. | ||||
REF 46 | Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b.Hepatology. 2013 Mar;57(3):1055-67. | ||||
REF 47 | MicroRNA-125a-5p regulates cancer cell proliferation and migration through NAIF1 in prostate carcinoma.Onco Targets Ther. 2015 Dec 17;8:3827-35. | ||||
REF 48 | MiR-125a regulates ovarian cancer proliferation and invasion by repressing GALNT14 expression.Biomed Pharmacother. 2016 May;80:381-387. | ||||
REF 49 | Micro-RNA regulation of the mammalian lin-28 gene during neuronal differentiation of embryonal carcinoma cells.Mol Cell Biol. 2005 Nov;25(21):9198-208. | ||||
REF 50 | Suppression of microRNA-125a-5p upregulates the TAZ-EGFR signaling pathway and promotes retinoblastoma proliferation.Cell Signal. 2016 Aug;28(8):850-60. | ||||
REF 51 | miRNA-dependent cross-talk between VEGF and Ang-2 in hypoxia-induced microvascular dysfunction. Biochem Biophys Res Commun. 2014 Sep 26;452(3):428-35. | ||||
REF 52 | A Zbtb7a proto-oncogene as a novel target for miR-125a.Mol Carcinog. 2016 Dec;55(12):2001-2009. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.