miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-125a-5p
miRNA Stemloop AC MI0000469
miRNA Stemloop ID hsa-mir-125a
Sequence ucccugagacccuuuaaccuguga
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [2]
Janus kinase 2 (JAK-2) Successful Target Target Info [3]
Serine/threonine-protein kinase mTOR (mTOR) Successful Target Target Info [4]
NT-3 growth factor receptor (TrkC) Successful Target Target Info [5]
PI3-kinase gamma (PIK3CG) Successful Target Target Info [4]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [6]
Estrogen-related receptor-alpha (ESRRA) Successful Target Target Info [7]
Interferon-gamma (IFNG) Successful Target Target Info [8]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [9]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [10]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [4]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [11]
Retinoic acid receptor alpha (RARA) Clinical trial Target Target Info [12]
Stress-activated protein kinase 2a (p38 alpha) Clinical trial Target Target Info [13]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [14]
Erbb3 tyrosine kinase receptor (Erbb-3) Clinical trial Target Target Info [2]
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Clinical trial Target Target Info [6]
Proto-oncogene c-RAF (c-RAF) Clinical trial Target Target Info [15]
Leukemia inhibitory factor receptor (LIFR) Clinical trial Target Target Info [16]
T-cell-specific protein RANTES (CCL5) Clinical trial Target Target Info [17]
Delta-like protein 4 (DLL4) Clinical trial Target Target Info [18]
Hematopoietic progenitor cell antigen CD34 (CD34) Clinical trial Target Target Info [19]
Histone deacetylase 5 (HDAC5) Patented-recorded Target Target Info [20]
Caspase-2 (CASP2) Patented-recorded Target Target Info [21]
Matrix metalloproteinase-11 (MMP-11) Literature-reported Target Target Info [22]
TNF receptor-associated factor 6 (TRAF6) Literature-reported Target Target Info [23]
Tyrosine-protein kinase ABL2 (ABL2) Literature-reported Target Target Info [24]
Zinc finger protein A20 (TNFAIP3) Literature-reported Target Target Info [25]
Apoptosis regulator BAK (BAK) Literature-reported Target Target Info [26]
Endothelin-1 (EDN1) Literature-reported Target Target Info [27]
ELAV-like protein 1 (ELAVL1) Literature-reported Target Target Info [28]
Eukaryotic translation initiation factor 4E-binding protein 1 (EIF4EBP1) Literature-reported Target Target Info [29]
Leukemia inhibitory factor (LIF) Clinical trial Target Target Info [30]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [31]
HCLS1-associated protein X-1 (HAX1) Literature-reported Target Target Info [32]
Protein(s) Regulated by This miRNA AT-rich interactive domain-containing protein 3A Regulated Protein
ARI3A_HUMAN
[33]
AT-rich interactive domain-containing protein 3B Regulated Protein
ARI3B_HUMAN
[34]
Bcl-2-like protein 12 Regulated Protein
B2L12_HUMAN
[6]
Beta-1,3-N-acetylglucosaminyltransferase lunatic fringe Regulated Protein
LFNG_HUMAN
[36]
Beta-1,4-galactosyltransferase 1 Regulated Protein
B4GT1_HUMAN
[37]
C-type lectin domain family 5 member A Regulated Protein
CLC5A_HUMAN
[38]
Dedicator of cytokinesis protein 3 Regulated Protein
DOCK3_HUMAN
[37]
Disintegrin and metalloproteinase domain-containing protein 9 Regulated Protein
ADAM9_HUMAN
[39]
Ethanolamine kinase 2 Regulated Protein
EKI2_HUMAN
[37]
Grainyhead-like protein 1 homolog Regulated Protein
GRHL1_HUMAN
[37]
GTP-binding protein Rit1 Regulated Protein
RIT1_HUMAN
[37]
Hexokinase-2 Regulated Protein
HXK2_HUMAN
[40]
Interleukin-1 receptor antagonist protein Regulated Protein
IL1RA_HUMAN
[37]
Krueppel-like factor 13 Regulated Protein
KLF13_HUMAN
[17]
Krueppel-like factor 13 Regulated Protein
KLF13_HUMAN
[42]
Mannan-binding lectin serine protease 1 Regulated Protein
MASP1_HUMAN
[39]
Microtubule-associated tumor suppressor 1 Regulated Protein
MTUS1_HUMAN
[12]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[44]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[45]
Multiple epidermal growth factor-like domains protein 9 Regulated Protein
MEGF9_HUMAN
[37]
NAD-dependent protein deacetylase sirtuin-7 Regulated Protein
SIR7_HUMAN
[46]
Niban-like protein 1 Regulated Protein
NIBL1_HUMAN
[37]
Nuclear apoptosis-inducing factor 1 Regulated Protein
NAIF1_HUMAN
[47]
Polypeptide N-acetylgalactosaminyltransferase 14 Regulated Protein
GLT14_HUMAN
[48]
PR domain zinc finger protein 1 Regulated Protein
PRDM1_HUMAN
[37]
Protein lin-28 homolog A Regulated Protein
LN28A_HUMAN
[49]
Reticulon-2 Regulated Protein
RTN2_HUMAN
[39]
Tafazzin Regulated Protein
TAZ_HUMAN
[50]
Thyrotroph embryonic factor Regulated Protein
TEF_HUMAN
[39]
Ubiquitin-conjugating enzyme E2 L3 Regulated Protein
UB2L3_HUMAN
[39]
Vacuolar protein sorting-associated protein 51 homolog Regulated Protein
VPS51_HUMAN
[51]
Zinc finger and BTB domain-containing protein 7A Regulated Protein
ZBT7A_HUMAN
[52]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[37]
References
REF 1 miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. Leuk Res. 2014 Mar;38(3):402-10.
REF 2 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 3 Expression analysis of microRNA-125 in patients with polycythemia vera and essential thrombocythemia and correlation with JAK2 allele burden and laboratory findings. Int J Lab Hematol. 2015 Oct;37(5):661-7.
REF 4 miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686.
REF 5 MicroRNA profiling in human medulloblastoma. Int J Cancer. 2009 Feb 1;124(3):568-77.
REF 6 miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36.
REF 7 MicroRNA-125a reduces proliferation and invasion of oral squamous cell carcinoma cells by targeting estrogen-related receptor : implications for cancer therapeutics. J Biol Chem. 2014 Nov 14;289(46):32276-90.
REF 8 Dysregulation in microRNA expression is associated with alterations in immune functions in combat veterans with post-traumatic stress disorder. PLoS One. 2014 Apr 23;9(4):e94075.
REF 9 MiR-125a suppresses tumor growth, invasion and metastasis in cervical cancer by targeting STAT3. Oncotarget. 2015 Sep 22;6(28):25266-80.
REF 10 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 11 miR-125a-5p is a prognostic biomarker that targets HDAC4 to suppress breast tumorigenesis. Oncotarget. 2015 Jan 1;6(1):494-509.
REF 12 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 13 Down-regulation of miR-125a-5p is associated with salivary adenoid cystic carcinoma progression via targeting p38/JNK/ERK signal pathway. Am J Transl Res. 2017 Mar 15;9(3):1101-1113.
REF 14 MicroRNA 125a and its regulation of the p53 tumor suppressor gene. FEBS Lett. 2009 Nov 19;583(22):3725-30.
REF 15 MicroRNA-125a-5p Is a Downstream Effector of Sorafenib in Its Antiproliferative Activity Toward Human Hepatocellular Carcinoma Cells. J Cell Physiol. 2017 Jul;232(7):1907-1913.
REF 16 MicroRNA-125a influences breast cancer stem cells by targeting leukemia inhibitory factor receptor which regulates the Hippo signaling pathway. Oncotarget. 2015 Jul 10;6(19):17366-78.
REF 17 MicroRNA-125a contributes to elevated inflammatory chemokine RANTES levels via targeting KLF13 in systemic lupus erythematosus. Arthritis Rheum. 2010 Nov;62(11):3425-35.
REF 18 Exosomes secreted by mesenchymal stem cells promote endothelial cell angiogenesis by transferring miR-125a. J Cell Sci. 2016 Jun 1;129(11):2182-9.
REF 19 Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50.
REF 20 HDAC inhibitors target HDAC5, upregulate microRNA-125a-5p, and induce apoptosis in breast cancer cells. Mol Ther. 2015 Apr;23(4):656-66.
REF 21 MiR-125a-5p decreases after long non-coding RNA HOTAIR knockdown to promote cancer cell apoptosis by releasing caspase 2. Cell Death Dis. 2016 Mar 10;7:e2137.
REF 22 Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF. PLoS One. 2012;7(6):e40169.
REF 23 MiR-125a TNF receptor-associated factor 6 to inhibit osteoclastogenesis. Exp Cell Res. 2014 Feb 15;321(2):142-52.
REF 24 MicroRNA-125a-5p modulates human cervical carcinoma proliferation and migration by targeting ABL2. Drug Des Devel Ther. 2015 Dec 24;10:71-9.
REF 25 MicroRNAs miR-125a and miR-125b constitutively activate the NF-B pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci U S A. 2012 May 15;109(20):7865-70.
REF 26 MicroRNA miR-125a controls hematopoietic stem cell number. Proc Natl Acad Sci U S A. 2010 Aug 10;107(32):14229-34.
REF 27 A Single-Nucleotide Polymorphism in 3'-Untranslated Region of Endothelin-1 Reduces Risk of Dementia After Ischemic Stroke. Med Sci Monit. 2016 Apr 23;22:1368-74.
REF 28 MicroRNA-125a represses cell growth by targeting HuR in breast cancer. RNA Biol. 2009 Nov-Dec;6(5):575-83.
REF 29 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 30 Human multipotent stromal cells from bone marrow and microRNA: regulation of differentiation and leukemia inhibitory factor expression. Proc Natl Acad Sci U S A. 2008 Nov 25;105(47):18372-7.
REF 31 Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8.
REF 32 Inhibition of HAX-1 by miR-125a reverses cisplatin resistance in laryngeal cancer stem cells. Oncotarget. 2016 Dec 27;7(52):86446-86456.
REF 33 ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45.
REF 34 The epidermal growth factor receptor responsive miR-125a represses mesenchymal morphology in ovarian cancer cells.Neoplasia. 2009 Nov;11(11):1208-15.
REF 35 miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36.
REF 36 Mir-125a-5p-mediated regulation of Lfng is essential for the avian segmentation clock.Dev Cell. 2013 Mar 11;24(5):554-61.
REF 37 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 38 Myelodysplastic syndromes are induced by histone methylationltering ASXL1 mutations.J Clin Invest. 2013 Nov;123(11):4627-40.
REF 39 Adaptive expression of microRNA-125a in adipose tissue in response to obesity in mice and men.PLoS One. 2014 Mar 27;9(3):e91375.
REF 40 MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene.J Biol Chem. 2012 Jun 29;287(27):23227-35.
REF 41 MicroRNA-125a contributes to elevated inflammatory chemokine RANTES levels via targeting KLF13 in systemic lupus erythematosus. Arthritis Rheum. 2010 Nov;62(11):3425-35.
REF 42 miR-125a-5p regulates differential activation of macrophages and inflammation.J Biol Chem. 2013 Dec 6;288(49):35428-36.
REF 43 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 44 Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439.
REF 45 miR-125 potentiates early neural specification of human embryonic stem cells.Development. 2012 Apr;139(7):1247-57.
REF 46 Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b.Hepatology. 2013 Mar;57(3):1055-67.
REF 47 MicroRNA-125a-5p regulates cancer cell proliferation and migration through NAIF1 in prostate carcinoma.Onco Targets Ther. 2015 Dec 17;8:3827-35.
REF 48 MiR-125a regulates ovarian cancer proliferation and invasion by repressing GALNT14 expression.Biomed Pharmacother. 2016 May;80:381-387.
REF 49 Micro-RNA regulation of the mammalian lin-28 gene during neuronal differentiation of embryonal carcinoma cells.Mol Cell Biol. 2005 Nov;25(21):9198-208.
REF 50 Suppression of microRNA-125a-5p upregulates the TAZ-EGFR signaling pathway and promotes retinoblastoma proliferation.Cell Signal. 2016 Aug;28(8):850-60.
REF 51 miRNA-dependent cross-talk between VEGF and Ang-2 in hypoxia-induced microvascular dysfunction. Biochem Biophys Res Commun. 2014 Sep 26;452(3):428-35.
REF 52 A Zbtb7a proto-oncogene as a novel target for miR-125a.Mol Carcinog. 2016 Dec;55(12):2001-2009.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.