The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-331-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gccccugggccuauccuagaa
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-331-3p significantly decreased reporter gene activity relative to miR-NC , indicating that the NRP-2 3'UTR contains functional target sites for binding and activity of miR-331-3p. |
[3] |
Evidence Score (E-score) |
3 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
3 |
Sequencing |
[3] |
Representative Target(s) Regulated by This miRNA |
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-10b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagaaccgaauuugug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|