Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T73708 Target Info
Target Name Neuropilin-2 (NRP2)
Synonyms Vascular endothelial cell growth factor 165 receptor 2; VEGF165R2; Neuropilin2
Target Type Clinical trial Target
Gene Name NRP2
Biochemical Class Neuropilin and tolloid-like
UniProt ID
O60462
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-331-3p miRNA Info
miRNA Mature AC
MIMAT0000760
Sequence gccccugggccuauccuagaa
miRNA Species Homo sapiens
Regulation Mechanism miR-331-3p significantly decreased reporter gene activity relative to miR-NC , indicating that the NRP-2 3'UTR contains functional target sites for binding and activity of miR-331-3p. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 Sequencing [3]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
References  Top
REF 1 MicroRNA-331-3p Suppresses Cervical Cancer Cell Proliferation and E6/E7 Expression by Targeting NRP2. Int J Mol Sci. 2016 Aug 18;17(8). pii: E1351.
REF 2 miR-331-3p regulates expression of neuropilin-2 in glioblastoma. J Neurooncol. 2014 Jan;116(1):67-75.
REF 3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 4 Heparin impairs angiogenesis through inhibition of microRNA-10b. J Biol Chem. 2011 Jul 29;286(30):26616-27.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.