miRNA General Information
miRNA Mature ID hsa-miR-10b-5p
miRNA Stemloop AC MI0000267
miRNA Stemloop ID hsa-mir-10b
Sequence uacccuguagaaccgaauuugug
TTD Target(s) Regulated by This miRNA Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [1]
PI3-kinase alpha (PIK3CA) Successful Target Target Info [2]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [3]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [4]
Retinoic acid-inducible gene-1 (RIG-1) Clinical trial Target Target Info [5]
Syndecan-1 (SDC1) Clinical trial Target Target Info [6]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [4]
Platelet glycoprotein Ib alpha (CD42b) Clinical trial Target Target Info [7]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [8]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [9]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [10]
Neuropilin-2 (NRP2) Literature-reported Target Target Info [11]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [12]
Multiple tumor suppressor 1 (CDKN2A) Literature-reported Target Target Info [12]
Muscleblind-like protein 1 (MBNL2) Literature-reported Target Target Info [13]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [14]
Protein(s) Regulated by This miRNA Bcl-2-like protein 11 Regulated Protein [12]
Breast cancer type 1 susceptibility protein Regulated Protein [16]
CUB and sushi domain-containing protein 1 Regulated Protein [17]
Homeobox protein Hox-B3 Regulated Protein [18]
Homeobox protein Hox-D10 Regulated Protein [19]
Klotho Regulated Protein [20]
Microtubule-associated protein RP/EB family member 1 Regulated Protein [21]
Muscleblind-like protein 1 Regulated Protein [13]
Muscleblind-like protein 3 Regulated Protein [13]
Neurofibromin Regulated Protein [23]
Nuclear receptor corepressor 2 Regulated Protein [24]
Nuclear receptor subfamily 4 group A member 3 Regulated Protein [11]
Oxidoreductase HTATIP2 Regulated Protein [26]
Paired box protein Pax-6 Regulated Protein [4]
Piezo-type mechanosensitive ion channel component 1 Regulated Protein [28]
Programmed cell death protein 4 Regulated Protein [29]
Serine/Arginine-related protein 53 Regulated Protein [13]
Serine/arginine-rich splicing factor 1 Regulated Protein [30]
Squamous cell carcinoma antigen recognized by T-cells 3 Regulated Protein [13]
Transcription factor AP-2 gamma Regulated Protein [12]
Transformer-2 protein homolog beta Regulated Protein [30]
Tropomyosin alpha-1 chain Regulated Protein [29]
Zinc finger E-box-binding homeobox 1 Regulated Protein [2]
References
REF 1 Effect of miRNA-10b in regulating cellular steatosis level by targeting PPAR-alpha expression, a novel mechanism for the pathogenesis of NAFLD. J Gastroenterol Hepatol. 2010 Jan;25(1):156-63.
REF 2 MiR-10b Directly Targets ZEB1 and PIK3CA to Curb Adenomyotic Epithelial Cell Invasiveness via Upregulation of E-Cadherin and Inhibition of Akt Phosphorylation. Cell Physiol Biochem. 2015;35(6):2169-80.
REF 3 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 4 MicroRNA-10b pleiotropically regulates invasion, angiogenicity and apoptosis of tumor cells resembling mesenchymal subtype of glioblastoma multiforme. Cell Death Dis. 2012 Oct 4;3:e398.
REF 5 Reduction of TIP30 in esophageal squamous cell carcinoma cells involves promoter methylation and microRNA-10b. Biochem Biophys Res Commun. 2014 Oct 31;453(4):772-7.
REF 6 Targeting of syndecan-1 by micro-ribonucleic acid miR-10b modulates invasiveness of endometriotic cells via dysregulation of the proteolytic milieu and interleukin-6 secretion. Fertil Steril. 2013 Mar 1;99(3):871-881.e1.
REF 7 MicroRNAs 10a and 10b Regulate the Expression of Human Platelet Glycoprotein Ib for Normal Megakaryopoiesis. Int J Mol Sci. 2016 Nov 9;17(11). pii: E1873.
REF 8 MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 9 The High Mobility Group A proteins contribute to thyroid cell transformation by regulating miR-603 and miR-10b expression. Mol Oncol. 2013 Jun;7(3):531-42.
REF 10 Oncogenic cAMP responsive element binding protein 1 is overexpressed upon loss of tumor suppressive miR-10b-5p and miR-363-3p in renal cancer. Oncol Rep. 2016 Apr;35(4):1967-78.
REF 11 Heparin impairs angiogenesis through inhibition of microRNA-10b. J Biol Chem. 2011 Jul 29;286(30):26616-27.
REF 12 Human glioma growth is controlled by microRNA-10b. Cancer Res. 2011 May 15;71(10):3563-72.
REF 13 Therapeutic potential of targeting microRNA-10b in established intracranial glioblastoma: first steps toward the clinic. EMBO Mol Med. 2016 Mar 1;8(3):268-87.
REF 14 DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer. Gastric Cancer. 2015 Jan;18(1):43-54.
REF 15 Human glioma growth is controlled by microRNA-10b. Cancer Res. 2011 May 15;71(10):3563-72.
REF 16 Identification of miR-10b, miR-26a, miR-146a and miR-153 as potential triple-negative breast cancer biomarkers.Cell Oncol (Dordr). 2015 Dec;38(6):433-42.
REF 17 miR-10b exerts oncogenic activity in human hepatocellular carcinoma cells by targeting expression of CUB and sushi multiple domains 1 (CSMD1).BMC Cancer. 2016 Oct 18;16(1):806.
REF 18 miR-10b Inhibits Apoptosis and Promotes Proliferation and Invasion of Endometrial Cancer Cells via Targeting HOXB3.Cancer Biother Radiopharm. 2016 Aug;31(6):225-31.
REF 19 Tumour invasion and metastasis initiated by microRNA-10b in breast cancer.Nature. 2007 Oct 11;449(7163):682-8.
REF 20 microRNA miR-10b inhibition reduces cell proliferation and promotes apoptosis in non-small cell lung cancer (NSCLC) cells.Mol Biosyst. 2015 Jul;11(7):2051-9.
REF 21 Epigenetic regulation of microRNA-10b and targeting of oncogenic MAPRE1 in gastric cancer.Epigenetics. 2011 Jun;6(6):740-51.
REF 22 Therapeutic potential of targeting microRNA-10b in established intracranial glioblastoma: first steps toward the clinic. EMBO Mol Med. 2016 Mar 1;8(3):268-87.
REF 23 MicroRNA-10b regulates tumorigenesis in neurofibromatosis type 1.Cancer Sci. 2010 Sep;101(9):1997-2004.
REF 24 MicroRNAs 10a and 10b are potent inducers of neuroblastoma cell differentiation through targeting of nuclear receptor corepressor 2.Cell Death Differ. 2011 Jul;18(7):1089-98.
REF 25 Heparin impairs angiogenesis through inhibition of microRNA-10b. J Biol Chem. 2011 Jul 29;286(30):26616-27.
REF 26 microRNA-10b enhances pancreatic cancer cell invasion by suppressing TIP30 expression and promoting EGF and TGF- actions.Oncogene. 2014 Sep 18;33(38):4664-74.
REF 27 MicroRNA-10b pleiotropically regulates invasion, angiogenicity and apoptosis of tumor cells resembling mesenchymal subtype of glioblastoma multiforme. Cell Death Dis. 2012 Oct 4;3:e398.
REF 28 MicroRNA-10b is a prognostic indicator in colorectal cancer and confers resistance to the chemotherapeutic agent 5-fluorouracil in colorectal cancer cells.Ann Surg Oncol. 2012 Sep;19(9):3065-71.
REF 29 Co-inhibition of microRNA-10b and microRNA-21 exerts synergistic inhibition on the proliferation and invasion of human glioma cells.Int J Oncol. 2012 Sep;41(3):1005-12.
REF 30 MicroRNAs-10a and -10b contribute to retinoic acid-induced differentiation of neuroblastoma cells and target the alternative splicing regulatory factor SFRS1 (SF2/ASF).J Biol Chem. 2011 Feb 11;286(6):4150-64.
REF 31 MiR-10b Directly Targets ZEB1 and PIK3CA to Curb Adenomyotic Epithelial Cell Invasiveness via Upregulation of E-Cadherin and Inhibition of Akt Phosphorylation. Cell Physiol Biochem. 2015;35(6):2169-80.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.