Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T79160 |
Target Info
|
| Target Name |
Glial cell line-derived neurotrophic factor (GDNF) |
| Synonyms |
hGDNF; Glial cell linederived neurotrophic factor; Astrocytederived trophic factor; Astrocyte-derived trophic factor; ATF |
| Target Type |
Clinical trial Target |
| Gene Name |
GDNF |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuuggcacuagcacauuuuugcu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-96 serves as negative regulators of GDNF expression via interaction with GDNF 3'UTR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
In Situ Hybridization; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
GDNF Overexpression from the Native Locus Reveals its Role in the Nigrostriatal Dopaminergic System Function. PLoS Genet. 2015 Dec 17;11(12):e1005710.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
