Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T80886 | Target Info | |||
| Target Name | Transcription regulator protein BACH1 (Bach1) | ||||
| Synonyms | HA2303; BTB and CNC homolog 1 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | BACH1 | ||||
| Biochemical Class | Basic leucine zipper bZIP | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuaaucgugauaggggu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 7 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| 3 | Luciferase Reporter Assay; Microarray; qRT-PCR | [3] | |||
| 4 | Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot | [4] | |||
| 5 | Microarray; qRT-PCR | [5] | |||
| 6 | qRT-PCR; Luciferase Reporter Assay | [6] | |||
| 7 | Reporter Assay | [7] | |||
| Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
| Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
| miRNA Mature ID | kshv-miR-K12-11-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuuagccuguguccga | ||||
| miRNA Species | Kaposi sarcoma-associated herpesvirus | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Transcription regulator protein BACH1 (Bach1) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol. 2008 Jun;82(11):5295-306. | ||||
| REF 2 | Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol. 2007 Dec;81(23):12836-45. | ||||
| REF 3 | MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proc Natl Acad Sci U S A. 2009 Feb 24;106(8):2735-40. | ||||
| REF 4 | Upregulation of MiR-155 in nasopharyngeal carcinoma is partly driven by LMP1 and LMP2A and downregulates a negative prognostic marker JMJD1A. PLoS One. 2011 Apr 26;6(4):e19137. | ||||
| REF 5 | Identification of putative pathogenic microRNA and its downstream targets in anaplastic lymphoma kinase-negative anaplastic large cell lymphoma. Hum Pathol. 2014 Oct;45(10):1995-2005. | ||||
| REF 6 | Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J Exp Med. 2008 Mar 17;205(3):585-94. | ||||
| REF 7 | Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.