Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T80896 |
Target Info
|
Target Name |
Estrogen receptor beta (ESR2) |
Synonyms |
Oestrogen receptor beta; Nuclear receptor subfamily 3 group A member 2; NR3A2; Erbeta; ESTRB; ER-beta; Beta-1 |
Target Type |
Successful Target |
Gene Name |
ESR2 |
Biochemical Class |
Nuclear hormone receptor |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-30a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccucgacuggaag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Expression of a mimic of miR-30a-5p, a direct target and downstream effector of ERB in breast cancer, led to the identification of several target transcripts of this miRNA. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-95-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaauaaaugucuguugaauu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Estrogen receptor beta (ESR2)
|
Target Info
|
|
References |
Top |
REF 1 |
Post-transcriptional regulation of human breast cancer cell proteome by unliganded estrogen receptor via microRNAs. Mol Cell Proteomics. 2014 Apr;13(4):1076-90.
|
REF 2 |
Calycosin induces apoptosis in colorectal cancer cells, through modulating the ER/MiR-95 and IGF-1R, PI3K/Akt signaling pathways. Gene. 2016 Oct 10;591(1):123-128.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.