Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T82028 |
Target Info
|
| Target Name |
Sodium/hydrogen exchanger 1 (SLC9A1) |
| Synonyms |
Solute carrier family 9 member 1; Na+/H+ antiporter, amiloride-sensitive; Na(+)Sodium/hydrogen exchanger 1/H(+) exchanger 1; Na(+)/H(+) exchanger 1; Na(+)/H(+) antiporter, amiloride-sensitive; NHE1; NHE-1; Myocardial Na+/H+ exchanger; APNH1; APNH |
| Target Type |
Clinical trial Target |
| Gene Name |
SLC9A1 |
| Biochemical Class |
Monovalent cation:proton antiporter-1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-185-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagagaaaggcaguuccuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Both SLC9A1 mRNA and protein expression were markedly reduced by miR-185 overexpression in neonatal rat ventricular myocytes which suggests that miR-185 negatively regulates SLC9A1 expression both at the mRNA and protein levels and that the negative effect is mediated by direct binding of miR-185 to the 3'UTR of SLC9A1 mRNA. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
|
Arachidonate 12-lipoxygenase (12-LOX)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-185 inhibits endoplasmic reticulum stress-induced apoptosis by targeting Na+/H+ exchanger-1 in the heart. BMB Rep. 2016 Apr;49(4):208-13. News
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
