Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82393 Target Info
Target Name TNF alpha converting enzyme (ADAM17)
Synonyms TNFalpha converting enzyme; TNF-alpha-converting enzyme; TNF-alpha converting enzyme; TNF-alpha convertase; TACE; Snake venom-like protease; Disintegrin and metalloproteinase domain-containing protein 17; CSVP; CD156b antigen; CD156b; ADAM 17; A disintegrin and metalloproteinase domain 17
Target Type Clinical trial Target
Gene Name ADAM17
Biochemical Class Peptidase
UniProt ID
P78536
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-122-5p resulted in the decreased protein level of target ADAM17. [1]
Evidence Score (E-score) 4 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 represses ADAM17 expression by binding the 3'UTR of ADAM17 mRNA. [7]
Evidence Score (E-score) 4 +
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism ADAM17 is identified as a target of miR-152 and was inversely correlated with miR-152 in NSCLC tissues. [10]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism ADAM17 is a direct target of miR-338-3p, and ADAM17 overexpression partially attenuated the tumor suppressive effect of miR-338-3p in gastric cancer cells. [11]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
References  Top
REF 1 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 2 The microRNA network and tumor metastasis. Oncogene. 2010 Feb 18;29(7):937-48.
REF 3 Circulating microRNAs as Potential Diagnostic and Prognostic Biomarkers in Hepatocellular Carcinoma. Sci Rep. 2019 Jul 18;9(1):10464.
REF 4 Delivery of Liver-Specific miRNA-122 Using a Targeted Macromolecular Prodrug toward Synergistic Therapy for Hepatocellular Carcinoma. ACS Appl Mater Interfaces. 2019 Mar 20;11(11):10578-10588.
REF 5 miR145 targets the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6-mediated paracrine effects in head and neck cancer. Cancer Res. 2013 Jun 1;73(11):3425-40.
REF 6 MicroRNA-145 targets the metalloprotease ADAM17 and is suppressed in renal cell carcinoma patients. Neoplasia. 2013 Feb;15(2):218-30.
REF 7 MiR-145 reduces ADAM17 expression and inhibits in vitro migration and invasion of glioma cells. Oncol Rep. 2013 Jan;29(1):67-72.
REF 8 MicroRNA-145 overexpression attenuates apoptosis and increases matrix synthesis in nucleus pulposus cells. Life Sci. 2019 Mar 15;221:274-283.
REF 9 MiR-152 reduces human umbilical vein endothelial cell proliferation and migration by targeting ADAM17. FEBS Lett. 2014 Jun 5;588(12):2063-9.
REF 10 MicroRNA-152 targets ADAM17 to suppress NSCLC progression. FEBS Lett. 2014 May 21;588(10):1983-8.
REF 11 MiR-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10922-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.