Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82702 Target Info
Target Name Pregnane X receptor (NR1I2)
Synonyms Steroid and xenobiotic receptor; SXR; PXR; Orphan nuclear receptor PXR; Orphan nuclear receptor PAR1; Nuclear receptor subfamily 1 group I member 2
Target Type Literature-reported Target
Gene Name NR1I2
Biochemical Class Nuclear hormone receptor
UniProt ID
O75469
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-148a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target NR1I2; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target NR1I2. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 RT-PCR [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism miR-18a-5p was a post-transcriptional regulator of hPXR,. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-30c-1-3p miRNA Info
miRNA Mature AC
MIMAT0004674
Sequence cugggagaggguuguuuacucc
miRNA Species Homo sapiens
Regulation Mechanism miR-30c-1-3p was identified to suppress PXR by targeting the 3'untranslated region(UTR). [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Pregnane X receptor (NR1I2) Target Info
NR1I2_HUMAN
References  Top
REF 1 Post-transcriptional regulation of human pregnane X receptor by micro-RNA affects the expression of cytochrome P450 3A4. J Biol Chem. 2008 Apr 11;283(15):9674-80.
REF 2 Downregulated microRNA-148b in circulating PBMCs in chronic myeloid leukemia patients with undetectable minimal residual disease: a possible biomar... Drug Des Devel Ther. 2014 Aug 25;8:1151-9.
REF 3 Negative Regulation of Human Pregnane X Receptor by MicroRNA-18a-5p: Evidence for Suppression of MicroRNA-18a-5p Expression by Rifampin and Rilpivirine. Mol Pharmacol. 2017 Jul;92(1):48-56.
REF 4 MicroRNA-30c-1-3p is a silencer of the pregnane X receptor by targeting the 3'-untranslated region and alters the expression of its target gene cytochrome P450 3A4. Biochim Biophys Acta. 2016 Sep;1859(9):1238-1244.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.