The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Lentivirus-mediated miR-125a-5p upregulation inhibited cancer proliferation and migration in vitro and cervical carcinoma transplantation in vivo. ABL2 was directly targeted by miR-125a-5p. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-20a Promotes Prostate Cancer Invasion and Migration Through Targeting ABL2. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-26a-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccuauucuugguuacuugcacg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|