Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T83145 |
Target Info
|
| Target Name |
Nuclear factor NF-kappa-B (NFKB) |
| Synonyms |
Nuclear factor of kappa light polypeptide gene enhancer in B-cells; DNA-binding factor KBF |
| Target Type |
Successful Target |
| Gene Name |
NFKB1; NFKB2; RELA; RELB; REL |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-143-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaugaagcacuguagcuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-143 down-regulation induced decreased mRNA and protein expressions of NFKB2. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Connective tissue growth factor (CTGF)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-143 Targeting TAK1 Attenuates Pancreatic Ductal Adenocarcinoma Progression via MAPK and NF-B Pathway In Vitro. Dig Dis Sci. 2017 Apr;62(4):944-957.
|
| REF 2 |
miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
