miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-143-3p
miRNA Stemloop AC MI0000459
miRNA Stemloop ID hsa-mir-143
Sequence ugagaugaagcacuguagcuc
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Serine/threonine-protein kinase B-raf (BRAF) Successful Target Target Info [2]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [3]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
Tumor necrosis factor (TNF) Successful Target Target Info [5]
Nuclear factor NF-kappa-B (NFKB) Successful Target Target Info [1]
Prostaglandin G/H synthase 2 (COX-2) Successful Target Target Info [6]
Fragile histidine triad protein (FHIT) Successful Target Target Info [7]
S-mephenytoin 4-hydroxylase (CYP2C9) Successful Target Target Info [8]
Matrix metalloproteinase-13 (MMP-13) Clinical trial Target Target Info [9]
Matrix metalloproteinase-9 (MMP-9) Clinical trial Target Target Info [1]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [10]
Matrix metalloproteinase-14 (MMP-14) Clinical trial Target Target Info [1]
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Clinical trial Target Target Info [11]
Endothelial plasminogen activator inhibitor (SERPINE1) Clinical trial Target Target Info [12]
Integrin beta-1 (ITGB1) Clinical trial Target Target Info [1]
Syndecan-1 (SDC1) Clinical trial Target Target Info [13]
Toll-like receptor 2 (TLR2) Clinical trial Target Target Info [1]
Connective tissue growth factor (CTGF) Clinical trial Target Target Info [14]
Extracellular matrix receptor III (CD44) Clinical trial Target Target Info [2]
Fascin (FSCN1) Clinical trial Target Target Info [15]
DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Patented-recorded Target Target Info [16]
Extracellular signal-regulated kinase 5 (ERK5) Patented-recorded Target Target Info [17]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [18]
Hepatocyte nuclear factor 4-alpha (HNF4A) Literature-reported Target Target Info [19]
LIM domain kinase-1 (LIMK-1) Literature-reported Target Target Info [20]
GTPase HRas (HRAS) Literature-reported Target Target Info [21]
Interleukin 13 receptor alpha-1 (IL13RA1) Literature-reported Target Target Info [22]
Integrin alpha-4/beta-4 (ITGA4/B4) Literature-reported Target Target Info [1]
Protein(s) Regulated by This miRNA BAG family molecular chaperone regulator 3 Regulated Protein
BAG3_HUMAN
[23]
Collagen alpha-1(I) chain Regulated Protein
CO1A1_HUMAN
[24]
Collagen alpha-1(III) chain Regulated Protein
CO3A1_HUMAN
[25]
Dystrobrevin beta Regulated Protein
DTNB_HUMAN
[26]
Fibronectin type III domain-containing protein 3B Regulated Protein
FND3B_HUMAN
[27]
Gamma-aminobutyric acid receptor-associated protein-like 1 Regulated Protein
GBRL1_HUMAN
[28]
Hexokinase-2 Regulated Protein
HXK2_HUMAN
[29]
Krueppel-like factor 5 Regulated Protein
KLF5_HUMAN
[2]
Metastasis-associated in colon cancer protein 1 Regulated Protein
MACC1_HUMAN
[31]
Nuclear factor of activated T-cells, cytoplasmic 1 Regulated Protein
NFAC1_HUMAN
[32]
Nuclear receptor subfamily 2 group C member 2 Regulated Protein
NR2C2_HUMAN
[33]
Oxysterol-binding protein-related protein 8 Regulated Protein
OSBL8_HUMAN
[34]
Phosphatidylinositol 3-kinase regulatory subunit alpha Regulated Protein
P85A_HUMAN
[35]
Probable ATP-dependent RNA helicase DDX6 Regulated Protein
DDX6_HUMAN
[36]
Protein FAM83F Regulated Protein
FA83F_HUMAN
[37]
Protein jagged-1 Regulated Protein
JAG1_HUMAN
[38]
Ras-responsive element-binding protein 1 Regulated Protein
RREB1_HUMAN
[39]
Unconventional myosin-VI Regulated Protein
MYO6_HUMAN
[40]
References
REF 1 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 2 Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 3 Involvement of miR-143 in cisplatin resistance of gastric cancer cells via targeting IGF1R and BCL2. Tumour Biol. 2015 Apr;36(4):2737-45.
REF 4 MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells. FEBS J. 2009 Nov;276(22):6689-700.
REF 5 De-targeting by miR-143 decreases unwanted transgene expression in non-tumorigenic cells. Gene Ther. 2013 Nov;20(11):1104-9.
REF 6 Expression of miR-143 reduces growth and migration of human bladder carcinoma cells by targeting cyclooxygenase-2. Asian Pac J Cancer Prev. 2011;12(4):929-33.
REF 7 microRNA-143 protects cells from DNA damage-induced killing by downregulating FHIT expression. Cancer Biother Radiopharm. 2011 Jun;26(3):365-72.
REF 8 Suppression of CYP2C9 by microRNA hsa-miR-128-3p in human liver cells and association with hepatocellular carcinoma. Sci Rep. 2015 Feb 23;5:8534.
REF 9 MicroRNA-143 regulates human osteosarcoma metastasis by regulating matrix metalloprotease-13 expression. Mol Ther. 2011 Jun;19(6):1123-30.
REF 10 Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013 Jan 28;328(2):353-61.
REF 11 Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop. Oncogene. 2013 Jan 3;32(1):61-9.
REF 12 The miR-143/-145 cluster regulates plasminogen activator inhibitor-1 in bladder cancer. Br J Cancer. 2012 Jan 17;106(2):366-74.
REF 13 MicroRNA-143 targets Syndecan-1 to repress cell growth in melanoma. PLoS One. 2014 Apr 10;9(4):e94855.
REF 14 MicroRNA-143-3p inhibits hyperplastic scar formation by targeting connective tissue growth factor CTGF/CCN2 via the Akt/mTOR pathway. Mol Cell Biochem. 2016 May;416(1-2):99-108.
REF 15 MiRNA profile in esophageal squamous cell carcinoma: downregulation of miR-143 and miR-145. World J Gastroenterol. 2011 Jan 7;17(1):79-88.
REF 16 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 17 MicroRNA-143 regulates adipocyte differentiation. J Biol Chem. 2004 Dec 10;279(50):52361-5.
REF 18 MicroRNA-143-3p, up-regulated in H. pylori-positive gastric cancer, suppresses tumor growth, migration and invasion by directly targeting AKT2. Oncotarget. 2017 Apr 25;8(17):28711-28724.
REF 19 The role of microRNAs in hepatocyte nuclear factor-4alpha expression and transactivation. Biochim Biophys Acta. 2013 May;1829(5):436-42.
REF 20 miR-143 inhibits NSCLC cell growth and metastasis by targeting Limk1. Int J Mol Sci. 2014 Jul 7;15(7):11973-83.
REF 21 MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. Br J Cancer. 2009 Aug 18;101(4):699-706.
REF 22 MicroRNA-143 downregulates interleukin-13 receptor alpha1 in human mast cells. Int J Mol Sci. 2013 Aug 19;14(8):16958-69.
REF 23 MiR-143 enhances the antitumor activity of shikonin by targeting BAG3 expression in human glioblastoma stem cells.Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):105-12.
REF 24 Suppression of type I collagen production by microRNA-29b in cultured human stellate cells. Biochem Biophys Res Commun. 2010 Jan 1;391(1):316-21.
REF 25 MicroRNA-143 regulates collagen type III expression in stromal fibroblasts of scirrhous type gastric cancer.Cancer Sci. 2014 Feb;105(2):228-35.
REF 26 Identification of -Dystrobrevin as a Direct Target of miR-143: Involvement in Early Stages of Neural Differentiation.PLoS One. 2016 May 25;11(5):e0156325.
REF 27 Up-regulated microRNA-143 transcribed by nuclear factor kappa B enhances hepatocarcinoma metastasis by repressing fibronectin expression.Hepatology. 2009 Aug;50(2):490-9.
REF 28 MicroRNA-143 enhances chemosensitivity of Quercetin through autophagy inhibition via target GABARAPL1 in gastric cancer cells.Biomed Pharmacother. 2015 Aug;74:169-77.
REF 29 A novel miR-155/miR-143 cascade controls glycolysis by regulating hexokinase 2 in breast cancer cells.EMBO J. 2012 Apr 18;31(8):1985-98.
REF 30 Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 31 MicroRNA-143 targets MACC1 to inhibit cell invasion and migration in colorectal cancer.Mol Cancer. 2012 Apr 25;11:23.
REF 32 MiR-143-3p controls TGF-1-induced cell proliferation and extracellular matrix production in airway smooth muscle via negative regulation of the nuclear factor of activated T cells 1.Mol Immunol. 2016 Oct;78:133-139.
REF 33 The toll-like receptor 3 ligand, poly(I:C), improves immunosuppressive function and therapeutic effect of mesenchymal stem cells on sepsis via inhibiting MiR-143. Stem Cells. 2014 Feb;32(2):521-33.
REF 34 Oxysterol-binding protein-related protein 8 (ORP8) increases sensitivity of hepatocellular carcinoma cells to Fas-mediated apoptosis.J Biol Chem. 2015 Apr 3;290(14):8876-87.
REF 35 Comprehensive functional screening of miRNAs involved in fat cell insulin sensitivity among women.Am J Physiol Endocrinol Metab. 2017 Jun 1;312(6):E482-E494.
REF 36 DDX6 post-transcriptionally down-regulates miR-143/145 expression through host gene NCR143/145 in cancer cells.Biochim Biophys Acta. 2013 Oct;1829(10):1102-10.
REF 37 miR-143 inhibits tumor progression by targeting FAM83F in esophageal squamous cell carcinoma.Tumour Biol. 2016 Jul;37(7):9009-22.
REF 38 The miR-143/145 cluster is a novel transcriptional target of Jagged-1/Notch signaling in vascular smooth muscle cells.J Biol Chem. 2011 Aug 12;286(32):28312-21.
REF 39 RREB1 repressed miR-143/145 modulates KRAS signaling through downregulation of multiple targets.Oncogene. 2013 May 16;32(20):2576-85.
REF 40 The microRNA profile of prostate carcinoma obtained by deep sequencing.Mol Cancer Res. 2010 Apr;8(4):529-38.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.