Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88729 Target Info
Target Name Mitochondrial uncoupling protein 1 (UCP1)
Synonyms UCP 1; UCP; Thermogenin; Solute carrier family 25 member 7; SLC25A7; Mitochondrial brown fat uncoupling protein 1
Target Type Clinical trial Target
Gene Name UCP1
Biochemical Class Mitochondrial carrier
UniProt ID
P25874
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [1]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
References  Top
REF 1 Intravenous injection of microvesicle-delivery miR-130b alleviates high-fat diet-induced obesity in C57BL/6 mice through translational repression of PPAR-. J Biomed Sci. 2015 Oct 16;22:86.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.