Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T92076 |
Target Info
|
| Target Name |
Extracellular calcium-sensing receptor (CASR) |
| Synonyms |
hCasR; Parathyroid cell calciumreceptor; Parathyroid cell calcium-sensing receptor 1; Parathyroid calcium receptor; Parathyroid Cell calcium-sensing receptor; PCaR1; GPRC2A; CaSR |
| Target Type |
Successful Target |
| Gene Name |
CASR |
| Biochemical Class |
GPCR glutamate |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-135b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uauggcuuuucauuccuauguga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
3 |
+ |
| 1 |
Immunofluorescence |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| 3 |
Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
|
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-146b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaacugaauuccauaggcug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Inhibition of miR-146b expression led to high CASR levels and reduced proliferation. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunofluorescence |
[1] |
| Representative Target(s) Regulated by This miRNA |
Calgranulin D (S100A12)
|
Target Info
|
|
|
DNA-binding factor KBF1 (p105)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-31-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aggcaagaugcuggcauagcu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
LacZ Reporter Assay |
[4] |
| Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 1 (CDK1)
|
Target Info
|
|
|
Dickkopf-related protein 1 (DKK1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-135b- and miR-146b-dependent silencing of calcium-sensing receptor expression in colorectal tumors. Int J Cancer. 2016 Jan 1;138(1):137-45.
|
| REF 2 |
Exosomal miR-135b shed from hypoxic multiple myeloma cells enhances angiogenesis by targeting factor-inhibiting HIF-1. Blood. 2014 Dec 11;124(25):3748-57.
|
| REF 3 |
MicroRNA-135b acts as a tumor promoter by targeting the hypoxia-inducible factor pathway in genetically defined mouse model of head and neck squamous cell carcinoma. Cancer Lett. 2013 May 1;331(2):230-8.
|
| REF 4 |
miR-31 ablates expression of the HIF regulatory factor FIH to activate the HIF pathway in head and neck carcinoma. Cancer Res. 2010 Feb 15;70(4):1635-44.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
