Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T93727 |
Target Info
|
Target Name |
Secreted frizzled related protein-4 (SFRP4) |
Synonyms |
sFRP-4; Secreted frizzled-related protein 4; FrpHE; Frizzled protein, human endometrium |
Target Type |
Literature-reported Target |
Gene Name |
SFRP4 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-203a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agugguucuuaacaguucaacaguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-942-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucuucucuguuuuggccaugug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Glycogen synthase kinase-3 beta (GSK-3B)
|
Target Info
|
|
Melanoma differentiation-associated protein 6 (CDKN1A)
|
Target Info
|
|
References |
Top |
REF 1 |
miR-203 inhibits arecoline-induced epithelial-mesenchymal transition by regulating secreted frizzled-related protein 4 and transmembrane-4 L six family member 1 in oral submucous fibrosis. Oncol Rep. 2015 Jun;33(6):2753-60.
|
REF 2 |
miR-942 promotes cancer stem cell-like traits in esophageal squamous cell carcinoma through activation of Wnt/-catenin signalling pathway. Oncotarget. 2015 May 10;6(13):10964-77.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.