Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T96669 | Target Info | |||
Target Name | Clusterin (CLU) | ||||
Synonyms | Testosteronerepressed prostate message 2; Testosterone-repressed prostate message 2; TRPM-2; NA1/NA2; Ku70binding protein 1; Ku70-binding protein 1; KUB1; Complementassociated protein SP40,40; Complement-associated protein SP-40,40; Complement cytolysis inhibitor; Clusterin alpha chain; CLI; Apolipoprotein J; ApoJ; Apo-J; Agingassociated gene 4 protein; Aging-associated gene 4 protein; AAG4 | ||||
Target Type | Literature-reported Target | ||||
Gene Name | CLU | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-17-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaagugcuuacagugcagguag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The repression of miR-17 influences cell death upon DNA damage and mediates regulation of CLU in colon cancer cells. | [1] | |||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | CLU is a gene-specific target of miRNA-21. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | Estrogen receptor expression induces changes in the microRNA pool in human colon cancer cells. Carcinogenesis. 2013 Jul;34(7):1431-41. | ||||
REF 2 | The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46. | ||||
REF 3 | Clusterin is a gene-specific target of microRNA-21 in head and neck squamous cell carcinoma. Clin Cancer Res. 2014 Feb 15;20(4):868-77. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.