miRNA General Information
miRNA Mature ID	hsa-miR-17-5p
miRNA Stemloop AC	MI0000071
miRNA Stemloop ID	hsa-mir-17
Sequence	caaagugcuuacagugcagguag
TTD Target(s) Regulated by This miRNA	Matrix metalloproteinase-2 (MMP-2)	Successful Target	Target Info	[1]
	Amyloid beta A4 protein (APP)	Successful Target	Target Info	[2]
	Apoptosis regulator Bcl-2 (BCL-2)	Successful Target	Target Info	[3]
	ATP-binding cassette transporter A1 (ABCA1)	Successful Target	Target Info	[4]
	Janus kinase 1 (JAK-1)	Successful Target	Target Info	[5]
	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[6]
	Tumor necrosis factor (TNF)	Successful Target	Target Info	[7]
	Intercellular adhesion molecule ICAM-1 (ICAM1)	Successful Target	Target Info	[8]
	Low-density lipoprotein receptor (LDL-R)	Successful Target	Target Info	[9]
	Toll-like receptor 7 (TLR7)	Successful Target	Target Info	[7]
	Transforming growth factor beta 1 (TGFB1)	Successful Target	Target Info	[10]
	Vascular endothelial growth factor A (VEGFA)	Successful Target	Target Info	[2]
	Stress-activated protein kinase 2a (p38 alpha)	Clinical trial Target	Target Info	[11]
	Ubiquitin-protein ligase E3 Mdm2 (MDM2)	Clinical trial Target	Target Info	[9]
	Wee1-like protein kinase (WEE1)	Clinical trial Target	Target Info	[12]
	Yes tyrosine kinase (YES)	Clinical trial Target	Target Info	[13]
	Cellular tumor antigen p53 (TP53)	Clinical trial Target	Target Info	[14]
	DNA [cytosine-5]-methyltransferase 1 (DNMT1)	Clinical trial Target	Target Info	[15]
	Apoptosis mediating surface antigen FAS (FAS)	Clinical trial Target	Target Info	[14]
	E-selectin (SELE)	Clinical trial Target	Target Info	[8]
	G1/S-specific cyclin-D1 (CCND1)	Clinical trial Target	Target Info	[16]
	TGF-beta receptor type II (TGFBR2)	Clinical trial Target	Target Info	[9]
	Bone morphogenetic protein 2 (BMP2)	Clinical trial Target	Target Info	[17]
	Hypoxia-inducible factor 1 alpha (HIF-1A)	Clinical trial Target	Target Info	[18]
	E2F transcription factor 1 (E2F1)	Clinical trial Target	Target Info	[19]
	Hypoxia-inducible factor 2 alpha (HIF-2A)	Successful Target	Target Info	[20]
	Thrombospondin-1 (THBS1)	Clinical trial Target	Target Info	[5]
	TNF-related weak inducer of apoptosis (TWEAK)	Clinical trial Target	Target Info	[21]
	Stress-activated protein kinase JNK2 (JNK2)	Preclinical Target	Target Info	[22]
	Nuclear receptor coactivator 3 (NCOA3)	Literature-reported Target	Target Info	[23]
	Bone morphogenetic protein receptor (BMPR2)	Literature-reported Target	Target Info	[24]
	Calcium-activated potassium channel KCa1.1 (KCNMA1)	Clinical trial Target	Target Info	[25]
	Histone acetyltransferase KAT2B (KAT2B)	Literature-reported Target	Target Info	[26]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[27]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[28]
	Death-associated protein kinase 3 (DAPK3)	Literature-reported Target	Target Info	[29]
	LIM domain kinase-1 (LIMK-1)	Literature-reported Target	Target Info	[30]
	Breast cancer type 2 susceptibility protein (BRCA2)	Literature-reported Target	Target Info	[31]
	Cyclic AMP-responsive element-binding protein (CREB1)	Literature-reported Target	Target Info	[10]
	Integrin beta-8 (ITGB8)	Clinical trial Target	Target Info	[32]
	Insulin-like growth factor-binding protein 3 (IGFBP3)	Clinical trial Target	Target Info	[33]
	Melanoma differentiation-associated protein 6 (CDKN1A)	Literature-reported Target	Target Info	[24]
	Clusterin (CLU)	Literature-reported Target	Target Info	[34]
Protein(s) Regulated by This miRNA	25-hydroxycholesterol 7-alpha-hydroxylase	Regulated Protein	CP7B1_HUMAN	[35]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[36]
	C-C motif chemokine 1	Regulated Protein	CCL1_HUMAN	[13]
	Circadian locomoter output cycles protein kaput	Regulated Protein	CLOCK_HUMAN	[38]
	DnaJ homolog subfamily C member 27	Regulated Protein	DJC27_HUMAN	[13]
	Double-strand-break repair protein rad21 homolog	Regulated Protein	RAD21_HUMAN	[39]
	Double-stranded RNA-specific adenosine deaminase	Regulated Protein	DSRAD_HUMAN	[40]
	E3 SUMO-protein ligase EGR2	Regulated Protein	EGR2_HUMAN	[41]
	E3 ubiquitin-protein ligase SMURF1	Regulated Protein	SMUF1_HUMAN	[42]
	E3 ubiquitin-protein ligase TRIM8	Regulated Protein	TRIM8_HUMAN	[43]
	E3 ubiquitin-protein ligase TRIM8	Regulated Protein	TRIM8_HUMAN	[44]
	ETS translocation variant 1	Regulated Protein	ETV1_HUMAN	[45]
	F-box only protein 31	Regulated Protein	FBX31_HUMAN	[13]
	F-box only protein 31	Regulated Protein	FBX31_HUMAN	[46]
	G1/S-specific cyclin-D2	Regulated Protein	CCND2_HUMAN	[12]
	Heat shock protein beta-2	Regulated Protein	HSPB2_HUMAN	[1]
	HMG box-containing protein 1	Regulated Protein	HBP1_HUMAN	[49]
	Homeobox protein PKNOX1	Regulated Protein	PKNX1_HUMAN	[50]
	Integral membrane protein GPR137B	Regulated Protein	G137B_HUMAN	[13]
	Metalloproteinase inhibitor 3	Regulated Protein	TIMP3_HUMAN	[51]
	Mitofusin-2	Regulated Protein	MFN2_HUMAN	[52]
	Mitogen-activated protein kinase kinase kinase 12	Regulated Protein	M3K12_HUMAN	[53]
	Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[54]
	Mucin-17	Regulated Protein	MUC17_HUMAN	[55]
	Myocyte-specific enhancer factor 2D	Regulated Protein	MEF2D_HUMAN	[53]
	Netrin-4	Regulated Protein	NET4_HUMAN	[56]
	Neuronal PAS domain-containing protein 3	Regulated Protein	NPAS3_HUMAN	[57]
	NFX1-type zinc finger-containing protein 1	Regulated Protein	ZNFX1_HUMAN	[13]
	PDZ and LIM domain protein 7	Regulated Protein	PDLI7_HUMAN	[58]
	PH domain leucine-rich repeat-containing protein phosphatase 1	Regulated Protein	PHLP1_HUMAN	[59]
	Protein NPAT	Regulated Protein	NPAT_HUMAN	[13]
	Receptor-type tyrosine-protein phosphatase O	Regulated Protein	PTPRO_HUMAN	[60]
	Retinoblastoma-associated protein	Regulated Protein	RB_HUMAN	[12]
	Retinoblastoma-like protein 1	Regulated Protein	RBL1_HUMAN	[12]
	Retinoblastoma-like protein 2	Regulated Protein	RBL2_HUMAN	[12]
	Rho-related GTP-binding protein RhoE	Regulated Protein	RND3_HUMAN	[61]
	Runt-related transcription factor 1	Regulated Protein	RUNX1_HUMAN	[62]
	Serine/threonine-protein kinase D2	Regulated Protein	KPCD2_HUMAN	[63]
	Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform	Regulated Protein	2ABA_HUMAN	[64]
	SOSS complex subunit B2	Regulated Protein	SOSB2_HUMAN	[13]
	Suppressor of cytokine signaling 6	Regulated Protein	SOCS6_HUMAN	[65]
	TBC1 domain family member 2A	Regulated Protein	TBD2A_HUMAN	[66]
	Transcription elongation factor A protein-like 1	Regulated Protein	TCAL1_HUMAN	[67]
	Transcription factor E2-alpha	Regulated Protein	TFE2_HUMAN	[68]
	Transmembrane gamma-carboxyglutamic acid protein 1	Regulated Protein	TMG1_HUMAN	[56]
	Tumor protein p53-inducible nuclear protein 1	Regulated Protein	T53I1_HUMAN	[69]
	Tyrosine-protein phosphatase non-receptor type substrate 1	Regulated Protein	SHPS1_HUMAN	[70]
	Ubiquitin-conjugating enzyme E2 C	Regulated Protein	UBE2C_HUMAN	[71]
	Very low-density lipoprotein receptor	Regulated Protein	VLDLR_HUMAN	[72]
	Zinc finger and BTB domain-containing protein 4	Regulated Protein	ZBTB4_HUMAN	[73]
	Zinc finger FYVE domain-containing protein 9	Regulated Protein	ZFYV9_HUMAN	[74]
References
REF 1	miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 2	The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 3	miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4	Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1. Int J Clin Exp Med. 2015 Jan 15;8(1):674-81.
REF 5	Members of the microRNA-17-92 cluster exhibit a cell-intrinsic antiangiogenic function in endothelial cells. Blood. 2010 Jun 10;115(23):4944-50.
REF 6	HIF-1 downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation. Cell Death Differ. 2013 Mar;20(3):408-18.
REF 7	Microenvironmental interleukin-6 suppresses toll-like receptor signaling in human leukemia cells through miR-17/19A. Blood. 2015 Aug 6;126(6):766-78.
REF 8	Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 9	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 10	Placental expression of microRNA-17 and -19b is down-regulated in early pregnancy loss. Eur J Obstet Gynecol Reprod Biol. 2013 Jul;169(1):28-32.
REF 11	The miR-17/106-p38 axis is a key regulator of the neurogenic-to-gliogenic transition in developing neural stem/progenitor cells. Proc Natl Acad Sci U S A. 2014 Jan 28;111(4):1604-9.
REF 12	MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 13	A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 2009 Nov;37(20):e137.
REF 14	Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 15	Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405.
REF 16	MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 17	miR-17-5p and miR-106a are involved in the balance between osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells. Stem Cell Res. 2013 May;10(3):313-24.
REF 18	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 19	c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 20	MicroRNA-17, 20a regulates the proangiogenic function of tumor-associated macrophages via targeting hypoxia-inducible factor 2. PLoS One. 2013 Oct 23;8(10):e77890.
REF 21	Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.
REF 22	The miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition. Genome Biol. 2008;9(8):R127.
REF 23	Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. Mol Cell Biol. 2006 Nov;26(21):8191-201.
REF 24	Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 25	KCa1.1, a calcium-activated potassium channel subunit alpha 1, is targeted by miR-17-5p and modulates cell migration in malignant pleural mesothelioma. Mol Cancer. 2016 Jun 1;15(1):44.
REF 26	miR-17-5p targets the p300/CBP-associated factor and modulates androgen receptor transcriptional activity in cultured prostate cancer cells. BMC Cancer. 2012 Oct 24;12:492.
REF 27	miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009 Dec 15;23(24):2839-49.
REF 28	A cyclin D1/microRNA 17/20 regulatory feedback loop in control of breast cancer cell proliferation. J Cell Biol. 2008 Aug 11;182(3):509-17.
REF 29	Oncogenic miR-17/20a Forms a Positive Feed-forward Loop with the p53 Kinase DAPK3 to Promote Tumorigenesis. J Biol Chem. 2015 Aug 7;290(32):19967-75.
REF 30	The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PLoS One. 2012;7(9):e45761.
REF 31	miR-17-5p promotes the growth of osteosarcoma in a BRCC2-dependent mechanism. Oncol Rep. 2016 Mar;35(3):1473-82.
REF 32	MicroRNA-17/20a functions to inhibit cell migration and can be used a prognostic marker in oral squamous cell carcinoma. Oral Oncol. 2013 Sep;49(9):923-931.
REF 33	Interplay between microRNA-17-5p, insulin-like growth factor-II through binding protein-3 in hepatocellular carcinoma. World J Hepatol. 2016 Aug 18;8(23):976-84.
REF 34	Estrogen receptor expression induces changes in the microRNA pool in human colon cancer cells. Carcinogenesis. 2013 Jul;34(7):1431-41.
REF 35	MicroRNA-17 induces epithelial-mesenchymal transition consistent with the cancer stem cell phenotype by regulating CYP7B1 expression in colon cancer.Int J Mol Med. 2016 Aug;38(2):499-506.
REF 36	A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference.Nucleic Acids Res. 2009 Feb;37(3):e24.
REF 37	A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 2009 Nov;37(20):e137.
REF 38	A novel role of microRNA 17-5p in the modulation of circadian rhythm.Sci Rep. 2016 Jul 21;6:30070.
REF 39	The regulatory and predictive functions of miR-17 and miR-92 families on cisplatin resistance of non-small cell lung cancer. BMC Cancer. 2015 Oct 19;15:731.
REF 40	MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth.J Clin Invest. 2013 Jun;123(6):2703-18.
REF 41	MicroRNA-17-5p promotes gastric cancer proliferation, migration and invasion by directly targeting early growth response 2. Am J Cancer Res. 2016 Sep 1;6(9):2010-2020.
REF 42	MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis.Stem Cells. 2011 Nov;29(11):1804-16.
REF 43	TRIM8 downregulation in glioma affects cell proliferation and it is associated with patients survival.BMC Cancer. 2015 Jun 16;15:470.
REF 44	TRIM8 restores p53 tumour suppressor function by blunting N-MYC activity in chemo-resistant tumours.Mol Cancer. 2017 Mar 21;16(1):67.
REF 45	MiR-17-92 and miR-221/222 cluster members target KIT and ETV1 in human gastrointestinal stromal tumours. Br J Cancer. 2013 Sep 17;109(6):1625-35.
REF 46	F-box protein FBXO31 is down-regulated in gastric cancer and negatively regulated by miR-17 and miR-20a.Oncotarget. 2014 Aug 15;5(15):6178-90.
REF 47	MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 48	miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 49	miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1.Breast Cancer Res Treat. 2011 Apr;126(3):565-75.
REF 50	The miR-17 2 cluster contributes to MLL leukemia through the repression of MEIS1 competitor PKNOX1.Leuk Res. 2016 Jul;46:51-60.
REF 51	Both mature miR-17-5p and passenger strand miR-17-3p target TIMP3 and induce prostate tumor growth and invasion.Nucleic Acids Res. 2013 Nov;41(21):9688-704.
REF 52	Upregulated miR-17 Regulates Hypoxia-Mediated Human Pulmonary Artery Smooth Muscle Cell Proliferation and Apoptosis by Targeting Mitofusin 2.Med Sci Monit. 2016 Sep 18;22:3301-8.
REF 53	Down-regulation of miR-17 family expression in response to retinoic acid induced neuronal differentiation. Cell Signal. 2009 Dec;21(12):1837-45.
REF 54	The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46.
REF 55	DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56.
REF 56	MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22.
REF 57	Expression of NPAS3 in the human cortex and evidence of its posttranscriptional regulation by miR-17 during development, with implications for schizophrenia.Schizophr Bull. 2013 Mar;39(2):396-406.
REF 58	Evolutionary conservation of primate lymphocryptovirus microRNA targets.J Virol. 2014 Feb;88(3):1617-35.
REF 59	The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72.
REF 60	Protein tyrosine phosphatase receptor-type O (PTPRO) is co-regulated by E2F1 and miR-17-92.FEBS Lett. 2008 Aug 20;582(19):2850-6.
REF 61	Up-regulated miR-17 promotes cell proliferation, tumour growth and cell cycle progression by targeting the RND3 tumour suppressor gene in colorectal carcinoma.Biochem J. 2012 Mar 1;442(2):311-21.
REF 62	MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation.Nat Cell Biol. 2007 Jul;9(7):775-87.
REF 63	MicroRNA-17 post-transcriptionally regulates polycystic kidney disease-2 gene and promotes cell proliferation.Mol Biol Rep. 2010 Jul;37(6):2951-8.
REF 64	MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017 Feb;46:56-61.e1.
REF 65	miR-17-5p promotes proliferation by targeting SOCS6 in gastric cancer cells.FEBS Lett. 2014 Jun 5;588(12):2055-62.
REF 66	miR-17-5p regulates endocytic trafficking through targeting TBC1D2/Armus. PLoS One. 2012;7(12):e52555.
REF 67	Unraveling natalizumab effects on deregulated miR-17 expression in CD4+ T cells of patients with relapsing-remitting multiple sclerosis. J Immunol Res. 2014;2014:897249.
REF 68	TCF3, a novel positive regulator of osteogenesis, plays a crucial role in miR-17 modulating the diverse effect of canonical Wnt signaling in different microenvironments.Cell Death Dis. 2013 Mar 14;4:e539.
REF 69	MiR-17-5p targets TP53INP1 and regulates cell proliferation and apoptosis of cervical cancer cells.IUBMB Life. 2012 Aug;64(8):697-704.
REF 70	MicroRNA-17/20a/106a modulate macrophage inflammatory responses through targeting signal-regulatory protein .J Allergy Clin Immunol. 2013 Aug;132(2):426-36.e8.
REF 71	Inhibition of microRNA-17/20a suppresses cell proliferation in gastric cancer by modulating UBE2C expression.Oncol Rep. 2015 May;33(5):2529-36.
REF 72	Knockdown of microRNA-17-5p ameliorates atherosclerotic lesions in ApoE-/- mice and restores the expression of very low density lipoprotein receptor.Biotechnol Lett. 2017 Jul;39(7):967-976.
REF 73	Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730.
REF 74	MicroRNA-17/20a impedes migration and invasion via TGF-/ITGB6 pathway in esophageal squamous cell carcinoma. Am J Cancer Res. 2016 Jul 1;6(7):1549-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.