miRNA General Information
miRNA Mature ID hsa-miR-17-5p
miRNA Stemloop AC MI0000071
miRNA Stemloop ID hsa-mir-17
Sequence caaagugcuuacagugcagguag
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Amyloid beta A4 protein (APP) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
ATP-binding cassette transporter A1 (ABCA1) Successful Target Target Info [4]
Janus kinase 1 (JAK-1) Successful Target Target Info [5]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [6]
Tumor necrosis factor (TNF) Successful Target Target Info [7]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [8]
Low-density lipoprotein receptor (LDL-R) Successful Target Target Info [9]
Toll-like receptor 7 (TLR7) Successful Target Target Info [7]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [10]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [2]
Stress-activated protein kinase 2a (p38 alpha) Clinical trial Target Target Info [11]
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Clinical trial Target Target Info [9]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [12]
Yes tyrosine kinase (YES) Clinical trial Target Target Info [13]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [14]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [15]
Apoptosis mediating surface antigen FAS (FAS) Clinical trial Target Target Info [14]
E-selectin (SELE) Clinical trial Target Target Info [8]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [16]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [9]
Bone morphogenetic protein 2 (BMP2) Clinical trial Target Target Info [17]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [18]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [19]
Hypoxia-inducible factor 2 alpha (HIF-2A) Clinical trial Target Target Info [20]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [5]
TNF-related weak inducer of apoptosis (TWEAK) Clinical trial Target Target Info [21]
Stress-activated protein kinase JNK2 (JNK2) Preclinical Target Target Info [22]
Nuclear receptor coactivator 3 (NCOA3) Literature-reported Target Target Info [23]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [24]
Calcium-activated potassium channel KCa1.1 (KCNMA1) Literature-reported Target Target Info [25]
Histone acetyltransferase KAT2B (KAT2B) Literature-reported Target Target Info [26]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [27]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [28]
Death-associated protein kinase 3 (DAPK3) Literature-reported Target Target Info [29]
LIM domain kinase-1 (LIMK-1) Literature-reported Target Target Info [30]
Breast cancer type 2 susceptibility protein (BRCA2) Literature-reported Target Target Info [31]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [10]
Integrin beta-8 (ITGB8) Patented-recorded Target Target Info [32]
Insulin-like growth factor-binding protein 3 (IGFBP3) Clinical trial Target Target Info [33]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [24]
Clusterin (CLU) Literature-reported Target Target Info [34]
Protein(s) Regulated by This miRNA 25-hydroxycholesterol 7-alpha-hydroxylase Regulated Protein [35]
Bcl-2-like protein 11 Regulated Protein [36]
C-C motif chemokine 1 Regulated Protein [13]
Circadian locomoter output cycles protein kaput Regulated Protein [38]
DnaJ homolog subfamily C member 27 Regulated Protein [13]
Double-strand-break repair protein rad21 homolog Regulated Protein [39]
Double-stranded RNA-specific adenosine deaminase Regulated Protein [40]
E3 SUMO-protein ligase EGR2 Regulated Protein [41]
E3 ubiquitin-protein ligase SMURF1 Regulated Protein [42]
E3 ubiquitin-protein ligase TRIM8 Regulated Protein [43]
E3 ubiquitin-protein ligase TRIM8 Regulated Protein [44]
ETS translocation variant 1 Regulated Protein [45]
F-box only protein 31 Regulated Protein [13]
F-box only protein 31 Regulated Protein [46]
G1/S-specific cyclin-D2 Regulated Protein [12]
Heat shock protein beta-2 Regulated Protein [1]
HMG box-containing protein 1 Regulated Protein [49]
Homeobox protein PKNOX1 Regulated Protein [50]
Integral membrane protein GPR137B Regulated Protein [13]
Metalloproteinase inhibitor 3 Regulated Protein [51]
Mitofusin-2 Regulated Protein [52]
Mitogen-activated protein kinase kinase kinase 12 Regulated Protein [53]
Mothers against decapentaplegic homolog 4 Regulated Protein [54]
Mucin-17 Regulated Protein [55]
Myocyte-specific enhancer factor 2D Regulated Protein [53]
Netrin-4 Regulated Protein [56]
Neuronal PAS domain-containing protein 3 Regulated Protein [57]
NFX1-type zinc finger-containing protein 1 Regulated Protein [13]
PDZ and LIM domain protein 7 Regulated Protein [58]
PH domain leucine-rich repeat-containing protein phosphatase 1 Regulated Protein [59]
Protein NPAT Regulated Protein [13]
Receptor-type tyrosine-protein phosphatase O Regulated Protein [60]
Retinoblastoma-associated protein Regulated Protein [12]
Retinoblastoma-like protein 1 Regulated Protein [12]
Retinoblastoma-like protein 2 Regulated Protein [12]
Rho-related GTP-binding protein RhoE Regulated Protein [61]
Runt-related transcription factor 1 Regulated Protein [62]
Serine/threonine-protein kinase D2 Regulated Protein [63]
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform Regulated Protein [64]
SOSS complex subunit B2 Regulated Protein [13]
Suppressor of cytokine signaling 6 Regulated Protein [65]
TBC1 domain family member 2A Regulated Protein [66]
Transcription elongation factor A protein-like 1 Regulated Protein [67]
Transcription factor E2-alpha Regulated Protein [68]
Transmembrane gamma-carboxyglutamic acid protein 1 Regulated Protein [56]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein [69]
Tyrosine-protein phosphatase non-receptor type substrate 1 Regulated Protein [70]
Ubiquitin-conjugating enzyme E2 C Regulated Protein [71]
Very low-density lipoprotein receptor Regulated Protein [72]
Zinc finger and BTB domain-containing protein 4 Regulated Protein [73]
Zinc finger FYVE domain-containing protein 9 Regulated Protein [74]
References
REF 1 miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 2 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 3 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4 Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1. Int J Clin Exp Med. 2015 Jan 15;8(1):674-81.
REF 5 Members of the microRNA-17-92 cluster exhibit a cell-intrinsic antiangiogenic function in endothelial cells. Blood. 2010 Jun 10;115(23):4944-50.
REF 6 HIF-1 downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation. Cell Death Differ. 2013 Mar;20(3):408-18.
REF 7 Microenvironmental interleukin-6 suppresses toll-like receptor signaling in human leukemia cells through miR-17/19A. Blood. 2015 Aug 6;126(6):766-78.
REF 8 Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 9 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 10 Placental expression of microRNA-17 and -19b is down-regulated in early pregnancy loss. Eur J Obstet Gynecol Reprod Biol. 2013 Jul;169(1):28-32.
REF 11 The miR-17/106-p38 axis is a key regulator of the neurogenic-to-gliogenic transition in developing neural stem/progenitor cells. Proc Natl Acad Sci U S A. 2014 Jan 28;111(4):1604-9.
REF 12 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 13 A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 2009 Nov;37(20):e137.
REF 14 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 15 Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405.
REF 16 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 17 miR-17-5p and miR-106a are involved in the balance between osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells. Stem Cell Res. 2013 May;10(3):313-24.
REF 18 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 19 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 20 MicroRNA-17, 20a regulates the proangiogenic function of tumor-associated macrophages via targeting hypoxia-inducible factor 2. PLoS One. 2013 Oct 23;8(10):e77890.
REF 21 Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.
REF 22 The miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition. Genome Biol. 2008;9(8):R127.
REF 23 Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. Mol Cell Biol. 2006 Nov;26(21):8191-201.
REF 24 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 25 KCa1.1, a calcium-activated potassium channel subunit alpha 1, is targeted by miR-17-5p and modulates cell migration in malignant pleural mesothelioma. Mol Cancer. 2016 Jun 1;15(1):44.
REF 26 miR-17-5p targets the p300/CBP-associated factor and modulates androgen receptor transcriptional activity in cultured prostate cancer cells. BMC Cancer. 2012 Oct 24;12:492.
REF 27 miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009 Dec 15;23(24):2839-49.
REF 28 A cyclin D1/microRNA 17/20 regulatory feedback loop in control of breast cancer cell proliferation. J Cell Biol. 2008 Aug 11;182(3):509-17.
REF 29 Oncogenic miR-17/20a Forms a Positive Feed-forward Loop with the p53 Kinase DAPK3 to Promote Tumorigenesis. J Biol Chem. 2015 Aug 7;290(32):19967-75.
REF 30 The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PLoS One. 2012;7(9):e45761.
REF 31 miR-17-5p promotes the growth of osteosarcoma in a BRCC2-dependent mechanism. Oncol Rep. 2016 Mar;35(3):1473-82.
REF 32 MicroRNA-17/20a functions to inhibit cell migration and can be used a prognostic marker in oral squamous cell carcinoma. Oral Oncol. 2013 Sep;49(9):923-931.
REF 33 Interplay between microRNA-17-5p, insulin-like growth factor-II through binding protein-3 in hepatocellular carcinoma. World J Hepatol. 2016 Aug 18;8(23):976-84.
REF 34 Estrogen receptor expression induces changes in the microRNA pool in human colon cancer cells. Carcinogenesis. 2013 Jul;34(7):1431-41.
REF 35 MicroRNA-17 induces epithelial-mesenchymal transition consistent with the cancer stem cell phenotype by regulating CYP7B1 expression in colon cancer.Int J Mol Med. 2016 Aug;38(2):499-506.
REF 36 A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference.Nucleic Acids Res. 2009 Feb;37(3):e24.
REF 37 A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 2009 Nov;37(20):e137.
REF 38 A novel role of microRNA 17-5p in the modulation of circadian rhythm.Sci Rep. 2016 Jul 21;6:30070.
REF 39 The regulatory and predictive functions of miR-17 and miR-92 families on cisplatin resistance of non-small cell lung cancer. BMC Cancer. 2015 Oct 19;15:731.
REF 40 MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth.J Clin Invest. 2013 Jun;123(6):2703-18.
REF 41 MicroRNA-17-5p promotes gastric cancer proliferation, migration and invasion by directly targeting early growth response 2. Am J Cancer Res. 2016 Sep 1;6(9):2010-2020.
REF 42 MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis.Stem Cells. 2011 Nov;29(11):1804-16.
REF 43 TRIM8 downregulation in glioma affects cell proliferation and it is associated with patients survival.BMC Cancer. 2015 Jun 16;15:470.
REF 44 TRIM8 restores p53 tumour suppressor function by blunting N-MYC activity in chemo-resistant tumours.Mol Cancer. 2017 Mar 21;16(1):67.
REF 45 MiR-17-92 and miR-221/222 cluster members target KIT and ETV1 in human gastrointestinal stromal tumours. Br J Cancer. 2013 Sep 17;109(6):1625-35.
REF 46 F-box protein FBXO31 is down-regulated in gastric cancer and negatively regulated by miR-17 and miR-20a.Oncotarget. 2014 Aug 15;5(15):6178-90.
REF 47 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 48 miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 49 miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1.Breast Cancer Res Treat. 2011 Apr;126(3):565-75.
REF 50 The miR-17 2 cluster contributes to MLL leukemia through the repression of MEIS1 competitor PKNOX1.Leuk Res. 2016 Jul;46:51-60.
REF 51 Both mature miR-17-5p and passenger strand miR-17-3p target TIMP3 and induce prostate tumor growth and invasion.Nucleic Acids Res. 2013 Nov;41(21):9688-704.
REF 52 Upregulated miR-17 Regulates Hypoxia-Mediated Human Pulmonary Artery Smooth Muscle Cell Proliferation and Apoptosis by Targeting Mitofusin 2.Med Sci Monit. 2016 Sep 18;22:3301-8.
REF 53 Down-regulation of miR-17 family expression in response to retinoic acid induced neuronal differentiation. Cell Signal. 2009 Dec;21(12):1837-45.
REF 54 The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46.
REF 55 DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56.
REF 56 MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22.
REF 57 Expression of NPAS3 in the human cortex and evidence of its posttranscriptional regulation by miR-17 during development, with implications for schizophrenia.Schizophr Bull. 2013 Mar;39(2):396-406.
REF 58 Evolutionary conservation of primate lymphocryptovirus microRNA targets.J Virol. 2014 Feb;88(3):1617-35.
REF 59 The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72.
REF 60 Protein tyrosine phosphatase receptor-type O (PTPRO) is co-regulated by E2F1 and miR-17-92.FEBS Lett. 2008 Aug 20;582(19):2850-6.
REF 61 Up-regulated miR-17 promotes cell proliferation, tumour growth and cell cycle progression by targeting the RND3 tumour suppressor gene in colorectal carcinoma.Biochem J. 2012 Mar 1;442(2):311-21.
REF 62 MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation.Nat Cell Biol. 2007 Jul;9(7):775-87.
REF 63 MicroRNA-17 post-transcriptionally regulates polycystic kidney disease-2 gene and promotes cell proliferation.Mol Biol Rep. 2010 Jul;37(6):2951-8.
REF 64 MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017 Feb;46:56-61.e1.
REF 65 miR-17-5p promotes proliferation by targeting SOCS6 in gastric cancer cells.FEBS Lett. 2014 Jun 5;588(12):2055-62.
REF 66 miR-17-5p regulates endocytic trafficking through targeting TBC1D2/Armus. PLoS One. 2012;7(12):e52555.
REF 67 Unraveling natalizumab effects on deregulated miR-17 expression in CD4+ T cells of patients with relapsing-remitting multiple sclerosis. J Immunol Res. 2014;2014:897249.
REF 68 TCF3, a novel positive regulator of osteogenesis, plays a crucial role in miR-17 modulating the diverse effect of canonical Wnt signaling in different microenvironments.Cell Death Dis. 2013 Mar 14;4:e539.
REF 69 MiR-17-5p targets TP53INP1 and regulates cell proliferation and apoptosis of cervical cancer cells.IUBMB Life. 2012 Aug;64(8):697-704.
REF 70 MicroRNA-17/20a/106a modulate macrophage inflammatory responses through targeting signal-regulatory protein .J Allergy Clin Immunol. 2013 Aug;132(2):426-36.e8.
REF 71 Inhibition of microRNA-17/20a suppresses cell proliferation in gastric cancer by modulating UBE2C expression.Oncol Rep. 2015 May;33(5):2529-36.
REF 72 Knockdown of microRNA-17-5p ameliorates atherosclerotic lesions in ApoE-/- mice and restores the expression of very low density lipoprotein receptor.Biotechnol Lett. 2017 Jul;39(7):967-976.
REF 73 Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730.
REF 74 MicroRNA-17/20a impedes migration and invasion via TGF-/ITGB6 pathway in esophageal squamous cell carcinoma. Am J Cancer Res. 2016 Jul 1;6(7):1549-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.