Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T97035 |
Target Info
|
| Target Name |
Tyrosinase (TYR) |
| Synonyms |
Tumor rejection antigen AB; SK29-AB; Monophenol monooxygenase; LB24-AB |
| Target Type |
Successful Target |
| Gene Name |
TYR |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-330-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucucugggccugugucuuaggc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
TYR is the target of miR-330-5p in human tissues. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
|
Mucin-1 (MUC1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-330-5p regulates tyrosinase and PDIA3 expression and suppresses cell proliferation and invasion in cutaneous malignant melanoma. J Surg Res. 2016 Jun 15;203(2):434-40.
|
| REF 2 |
miR-330-5p targets tyrosinase and induces depigmentation. J Invest Dermatol. 2014 Nov;134(11):2846-2849.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
