Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97174 Target Info
Target Name Mannose-6-phosphate receptor (M6PR)
Synonyms MPRD; MPR46; MPR 46; Cation-dependent mannose-6-phosphate receptor; CDMan-6-P receptor; CD-MPR; CD Man-6-P receptor; 46kDa mannose 6-phosphate receptor; 46 kDa mannose 6-phosphate receptor
Target Type Successful Target
Gene Name M6PR
Biochemical Class Mannose 6-phosphate receptor
UniProt ID
P20645
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism M6PR was validated as direct targets of miR-204. Down-regulation of expressions at protein levels of M6PR was confirmed by Western blot. [2]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism M6PR is generally down-regulated by miR-211 indirectly drives the expression of miR-211. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
References  Top
REF 1 Downregulation of miR-204 expression defines a highly aggressive subset of Group 3/Group 4 medulloblastomas. Acta Neuropathol Commun. 2019 Apr 3;7(1):52.
REF 2 Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007.
REF 3 New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.