Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T98264 Target Info
Target Name Protein-tyrosine phosphatase SHP-1 (PTPN6)
Synonyms Tyrosine-protein phosphatase non-receptor type 6; SH-PTP1; Protein-tyrosine phosphatase 1C; PTP1C; PTP-1C; Hematopoietic cell protein-tyrosine phosphatase; HCP
Target Type Patented-recorded Target
Gene Name PTPN6
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P29350
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1225-3p miRNA Info
miRNA Mature AC
MIMAT0005573
Sequence ugagccccugugccgcccccag
miRNA Species Homo sapiens
Regulation Mechanism PTPN6 is confirmed by qRT-PCR to be downregulated in miR-1225-3p transfected cells. [1]
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Immunoglobulin epsilon Fc receptor gamma (FCERG) Target Info
FCERG_HUMAN
Protein-tyrosine phosphatase SHP-1 (PTPN6) Target Info
PTN6_HUMAN
miRNA Mature ID hsa-miR-4649-3p miRNA Info
miRNA Mature AC
MIMAT0019712
Sequence ucugaggccugccucucccca
miRNA Species Homo sapiens
Regulation Mechanism miR-4649-3p directly targets PTPN6 by binding to the 3 untranslated region of PTPN6 mRNA. Overexpression of PTPN6 inversed the inhibited effect of miR-4649-3p mimics on cell proliferation. In conclusion, miR-4649-3p inhibits cell proliferation by targeting PTPN6 in NPC cells. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Protein-tyrosine phosphatase SHP-1 (PTPN6) Target Info
PTN6_HUMAN
References  Top
REF 1 Expression of regulatory platelet microRNAs in patients with sickle cell disease. PLoS One. 2013 Apr 12;8(4):e60932.
REF 2 MicroRNA-4649-3p inhibits cell proliferation by targeting protein tyrosine phosphatase SHP-1 in nasopharyngeal carcinoma cells. Int J Mol Med. 2015 Aug;36(2):559-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.