miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-214-5p | ||||
| miRNA Stemloop AC | MI0000290 | ||||
| miRNA Stemloop ID | hsa-mir-214 | ||||
| Sequence | ugccugucuacacuugcugugc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [3] | ||
| Cyclin-dependent kinase 3 (CDK3) | Clinical trial Target | Target Info | [1] | ||
| E3 ubiquitin protein ligase Itchy (ITCH) | Literature-reported Target | Target Info | [4] | ||
| Transcription factor E2F2 (E2F2) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Ras association domain-containing protein 5 | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | miR-214/199a/199a* cluster levels predict poor survival in hepatocellular carcinoma through interference with cell-cycle regulators. Oncotarget. 2016 Jan 5;7(1):929-45. | ||||
| REF 2 | MicroRNA-214 Reduces Insulin-like Growth Factor-1 (IGF-1) Receptor Expression and Downstream mTORC1 Signaling in Renal Carcinoma Cells. J Biol Chem. 2016 Jul 8;291(28):14662-76. | ||||
| REF 3 | Cantharidin inhibits cell proliferation and promotes apoptosis in tongue squamous cell carcinoma through suppression of miR-214 and regulation of p53 and Bcl-2/Bax. Oncol Rep. 2015 Jun;33(6):3061-8. | ||||
| REF 4 | Upregulated microRNA-214 enhances cardiac injury by targeting ITCH during coxsackievirus infection. Mol Med Rep. 2015 Jul;12(1):1258-64. | ||||
| REF 5 | MiR-214 regulates oral cancer KB cell apoptosis through targeting RASSF5. Genet Mol Res. 2017 Mar 8;16(1). | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.