miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-340-5p | ||||
| miRNA Stemloop AC | MI0000802 | ||||
| miRNA Stemloop ID | hsa-mir-340 | ||||
| Sequence | uuauaaagcaaugagacugauu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [2] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [3] | ||
| Rho-associated protein kinase 1 (ROCK1) | Successful Target | Target Info | [4] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [5] | ||
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [6] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [7] | ||
| Interleukin-4 (IL4) | Clinical trial Target | Target Info | [8] | ||
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [9] | ||
| Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [10] | ||
| Polypyrimidine tract-binding protein (PTBP1) | Literature-reported Target | Target Info | [11] | ||
| S-phase kinase-associated protein 2 (SKP2) | Literature-reported Target | Target Info | [12] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | Cyclin-G2 | Regulated Protein | [14] | ||
| G1/S-specific cyclin-D2 | Regulated Protein | [1] | |||
| Microphthalmia-associated transcription factor | Regulated Protein | [16] | |||
| Pumilio homolog 1 | Regulated Protein | [12] | |||
| Pumilio homolog 2 | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | miR-340 inhibits glioblastoma cell proliferation by suppressing CDK6, cyclin-D1 and cyclin-D2. Biochem Biophys Res Commun. 2015 May 8;460(3):670-7. | ||||
| REF 2 | miR-340 inhibition of breast cancer cell migration and invasion through targeting of oncoprotein c-Met. Cancer. 2011 Jul 1;117(13):2842-52. | ||||
| REF 3 | Hepatitis B virus promotes cancer cell migration by downregulating miR-340-5p expression to induce STAT3 overexpression. Cell Biosci. 2017 Apr 12;7:16. | ||||
| REF 4 | MicroRNA-340 suppresses osteosarcoma tumor growth and metastasis by directly targeting ROCK1. Biochem Biophys Res Commun. 2013 Aug 9;437(4):653-8. | ||||
| REF 5 | miR-340 Inhibits Proliferation and Induces Apoptosis in Gastric Cancer Cell Line SGC-7901, Possibly via the AKT Pathway. Med Sci Monit. 2017 Jan 6;23:71-77. | ||||
| REF 6 | MicroRNA-340 inhibits prostate cancer cell proliferation and metastasis by targeting the MDM2-p53 pathway. Oncol Rep. 2016 Feb;35(2):887-95. | ||||
| REF 7 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 8 | IL-4, a direct target of miR-340/429, is involved in radiation-induced aggressive tumor behavior in human carcinoma cells. Oncotarget. 2016 Dec 27;7(52):86836-86856. | ||||
| REF 9 | MicroRNA 340 is involved in UVB-induced dendrite formation through the regulation of RhoA expression in melanocytes. Mol Cell Biol. 2014 Sep 15;34(18):3407-20. | ||||
| REF 10 | Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589. | ||||
| REF 11 | miR-124, miR-137 and miR-340 regulate colorectal cancer growth via inhibition of the Warburg effect. Oncol Rep. 2012 Oct;28(4):1346-52. | ||||
| REF 12 | miR-340 inhibits tumor cell proliferation and induces apoptosis by targeting multiple negative regulators of p27 in non-small cell lung cancer. Oncogene. 2015 Jun;34(25):3240-50. | ||||
| REF 13 | Modulation of neuroblastoma disease pathogenesis by an extensive network of epigenetically regulated microRNAs. Oncogene. 2013 Jun 13;32(24):2927-36. | ||||
| REF 14 | MicroRNA-340 promotes the tumor growth of human gastric cancer by inhibiting cyclin G2.Oncol Rep. 2016 Aug;36(2):1111-8. | ||||
| REF 15 | miR-340 inhibits glioblastoma cell proliferation by suppressing CDK6, cyclin-D1 and cyclin-D2. Biochem Biophys Res Commun. 2015 May 8;460(3):670-7. | ||||
| REF 16 | MicroRNA-340-mediated degradation of microphthalmia-associated transcription factor (MITF) mRNA is inhibited by coding region determinant-binding protein (CRD-BP).J Biol Chem. 2015 Jan 2;290(1):384-95. | ||||
| REF 17 | miR-340 inhibits tumor cell proliferation and induces apoptosis by targeting multiple negative regulators of p27 in non-small cell lung cancer. Oncogene. 2015 Jun;34(25):3240-50. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.