miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-410-3p | ||||
| miRNA Stemloop AC | MI0002465 | ||||
| miRNA Stemloop ID | hsa-mir-410 | ||||
| Sequence | aauauaacacagauggccugu | ||||
| TTD Target(s) Regulated by This miRNA | Angiotensin II receptor type-1 (AGTR1) | Successful Target | Target Info | [1] | |
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [2] | ||
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [3] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [4] | ||
| G2/mitotic-specific cyclin B1 (CCNB1) | Patented-recorded Target | Target Info | [5] | ||
| Jagged-2 protein (JAG2) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Hairy/enhancer-of-split related with YRPW motif protein 1 | Regulated Protein | [4] | ||
| Protein jagged-1 | Regulated Protein | [4] | |||
| Transcription factor HES-1 | Regulated Protein | [4] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | MicroRNA-410 functions as a tumor suppressor by targeting angiotensin II type 1 receptor in pancreatic cancer. IUBMB Life. 2015 Jan;67(1):42-53. | ||||
| REF 2 | MiR-410 regulates MET to influence the proliferation and invasion of glioma. Int J Biochem Cell Biol. 2012 Nov;44(11):1711-7. | ||||
| REF 3 | MicroRNA-410 suppresses migration and invasion by targeting MDM2 in gastric cancer. PLoS One. 2014 Aug 19;9(8):e104510. | ||||
| REF 4 | Tangeretin enhances radiosensitivity and inhibits the radiation-induced epithelial-mesenchymal transition of gastric cancer cells. Oncol Rep. 2015 Jul;34(1):302-10. | ||||
| REF 5 | Downregulation of miR-410 targeting the cyclin B1 gene plays a role in pituitary gonadotroph tumors. Cell Cycle. 2015;14(16):2590-7. | ||||
| REF 6 | Tangeretin enhances radiosensitivity and inhibits the radiation-induced epithelial-mesenchymal transition of gastric cancer cells. Oncol Rep. 2015 Jul;34(1):302-10. | ||||
| REF 7 | miR-410-3p suppresses breast cancer progression by targeting Snail.Oncol Rep. 2016 Jul;36(1):480-6. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.