Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00032 Target Info
Target Name Osteopontin (SPP1)
Synonyms Uropontin; Urinary stone protein; Secreted phosphoprotein 1; SPP-1; PSEC0156; OPN; Nephropontin; Bone sialoprotein 1; BNSP
Target Type Literature-reported Target
Gene Name SPP1
UniProt ID
P10451
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-299-5p miRNA Info
miRNA Mature AC
MIMAT0002890
Sequence ugguuuaccgucccacauacau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Osteopontin (SPP1) Target Info
OSTP_HUMAN
miRNA Mature ID hsa-miR-127-5p miRNA Info
miRNA Mature AC
MIMAT0004604
Sequence cugaagcucagagggcucugau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Osteopontin (SPP1) Target Info
OSTP_HUMAN
miRNA Mature ID hsa-miR-4262 miRNA Info
miRNA Mature AC
MIMAT0016894
Sequence gacauucagacuaccug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Osteopontin (SPP1) Target Info
OSTP_HUMAN
References  Top
REF 1 miR-146a induces differentiation of periodontal ligament cells. J Dent Res. 2010 Mar;89(3):252-7.
REF 2 Spheroid-forming subpopulation of breast cancer cells demonstrates vasculogenic mimicry via hsa-miR-299-5p regulated de novo expression of osteopontin. J Cell Mol Med. 2010 Jun;14(6B):1693-706.
REF 3 MicroRNA-127-5p regulates osteopontin expression and osteopontin-mediated proliferation of human chondrocytes. Sci Rep. 2016 Apr 29;6:25032.
REF 4 Regulation of osteosarcoma cell invasion through osteopontin modification by miR-4262. Tumour Biol. 2016 May;37(5):6493-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.