Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10383 Target Info
Target Name Phospholipase D2 (PLD2)
Synonyms hPLD2; Phosphatidylcholine-hydrolyzing phospholipase D2; PLD1C; PLD 2; Choline phosphatase 2
Target Type Clinical trial Target
Gene Name PLD2
Biochemical Class Phosphoric diester hydrolase
UniProt ID
O14939
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism The 3'UTR of PLD2 was the direct target of miR-203. [2]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-887-3p miRNA Info
miRNA Mature AC
MIMAT0004951
Sequence gugaacgggcgccaucccgagg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Interleukin-1 beta (IL1B) Target Info
IL1B_HUMAN
Phospholipase D2 (PLD2) Target Info
PLD2_HUMAN
miRNA Mature ID hsa-miR-3619-5p miRNA Info
miRNA Mature AC
MIMAT0017999
Sequence ucagcaggcaggcuggugcagc
miRNA Species Homo sapiens
Regulation Mechanism With the addition of miR-3619, a greater decrease in PLD2 translation after prolonged starvation. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Phospholipase D2 (PLD2) Target Info
PLD2_HUMAN
References  Top
REF 1 A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89.
REF 2 MicroRNA-203 inhibits the proliferation and invasion of U251 glioblastoma cells by directly targeting PLD2. Mol Med Rep. 2014 Feb;9(2):503-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.