Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13260 Target Info
Target Name Aromatase (CYP19A1)
Synonyms P-450AROM; Estrogen synthetase; Estrogen synthase; Cytochrome P450 19A1; Cytochrome P-450AROM; CYPXIX; CYP19; CYAR; ARO1
Target Type Successful Target
Gene Name CYP19A1
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
P11511
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase reporter assays were then performed to test whether miR-98 specifically interacts with this 3'UTR sequence to downregulate CYP19A1 expression. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a negatively regulates hCYP19A1 expression via elements in its 3'UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 Endometrial miR-181a and miR-98 expression is altered during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and TIMP3. J Clin Endocrinol Metab. 2012 Jul;97(7):E1316-26.
REF 2 Evidence for microRNA-mediated regulation of steroidogenesis by hypoxia. Environ Sci Technol. 2015 Jan 20;49(2):1138-47.
REF 3 The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. Mol Cell Biol. 2013 May;33(9):1782-96.
REF 4 Micro-RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase. Endocrinology. 2011 Oct;152(10):3941-51.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.