Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16769 Target Info
Target Name X-linked inhibitor of apoptosis protein (XIAP)
Synonyms hILP; hIAP3; hIAP-3; Xlinked IAP; X-linked IAP; RING-type E3 ubiquitin transferase XIAP; Inhibitor of apoptosis protein 3; ILP; IAPlike protein; IAP3; IAP-like protein; IAP-3; E3 ubiquitinprotein ligase XIAP; E3 ubiquitin-protein ligase XIAP; Baculoviral IAP repeatcontaining protein 4; Baculoviral IAP repeat-containing protein 4; BIRC4; API3
Target Type Clinical trial Target
Gene Name XIAP
Biochemical Class Acyltransferase
UniProt ID
P98170
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism Dual luciferase activity assay demonstrated that miR-192-5p reduced XIAP 3'UTR luciferase activity. However, the luciferase activity repression was significantly abrogated when XIAP 3'UTR was replaced with a mutated XIAP 3'UTR in which the miR-192-5p binding sites were disrupted. [1]
Evidence Score (E-score) 2 +
1 Microarray [1]
2 qRT-PCR; Luciferase Reporter Assay; Immunohistochemistry; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200c might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene XIAP. [4]
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-215-5p miRNA Info
miRNA Mature AC
MIMAT0000272
Sequence augaccuaugaauugacagac
miRNA Species Homo sapiens
Regulation Mechanism Dual luciferase activity assay demonstrated that miR-215 reduced XIAP 3'UTR luciferase activity. However, the luciferase activity repression was significantly abrogated when XIAP 3'UTR was replaced with a mutated XIAP 3'UTR in which the miR-215 binding sites were disrupted. [1]
Evidence Score (E-score) 2 +
1 Microarray [1]
2 qRT-PCR; Luciferase Reporter Assay; Immunohistochemistry; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130a directly targets XIAP, and participate in the regulation of apoptosis. The up-regulation of miR-130a led to a significant decrease in the XIAP mRNA levels and protein levels. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene XIAP. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism miR-23a expression correlated inversely with the expression of target gene X-linked inhibitor of apoptosis protein (XIAP). [9]
Evidence Score (E-score) 1 +
1 Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Regulation Mechanism A direct regulatory interaction of miR-34a-3p with the apoptosis inhibitor XIAP via binding to the first part of the XIAP 3'UTR. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-429 might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene XIAP. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-4782-3p miRNA Info
miRNA Mature AC
MIMAT0019945
Sequence ugauugucuucauaucuagaac
miRNA Species Homo sapiens
Regulation Mechanism miR-4782-3p inhibited cell proliferation in NSCLC by targeting XIAP. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Ubiquitin carboxyl-terminal hydrolase 14 (USP14) Target Info
UBP14_HUMAN
X-linked inhibitor of apoptosis protein (XIAP) Target Info
XIAP_HUMAN
References  Top
REF 1 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 2 Curcumin promotes apoptosis by activating the p53-miR-192-5p/215-XIAP pathway in non-small cell lung cancer. Cancer Lett. 2015 Feb 1;357(1):196-205.
REF 3 The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. Nat Med. 2015 Jun;21(6):619-27.
REF 4 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31.
REF 5 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 6 Curcumin inhibits cell growth and induces cell apoptosis through upregulation of miR-33b in gastric cancer. Tumour Biol. 2016 Oct;37(10):13177-13184.
REF 7 Downregulation of miR-130a contributes to cisplatin resistance in ovarian cancer cells by targeting X-linked inhibitor of apoptosis (XIAP) directly. Acta Biochim Biophys Sin (Shanghai). 2013 Dec;45(12):995-1001.
REF 8 CRNDE affects the malignant biological characteristics of human glioma stem cells by negatively regulating miR-186. Oncotarget. 2015 Sep 22;6(28):25339-55.
REF 9 Estradiol induces apoptosis via activation of miRNA-23a and p53: implication for gender difference in liver cancer development. Oncotarget. 2015 Oct 27;6(33):34941-52.
REF 10 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 11 Down-regulation of microRNA-34a* in rheumatoid arthritis synovial fibroblasts promotes apoptosis resistance. Arthritis Rheum. 2012 Jun;64(6):1771-9.
REF 12 MiR-4782-3p inhibited non-small cell lung cancer growth via USP14. Cell Physiol Biochem. 2014;33(2):457-67.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.