miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-130a-3p
miRNA Stemloop AC MI0000448
miRNA Stemloop ID hsa-mir-130a
Sequence cagugcaauguuaaaagggcau
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Platelet-derived growth factor receptor alpha (PDGFRA) Successful Target Target Info [2]
Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [3]
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) Successful Target Target Info [4]
Proto-oncogene c-Met (MET) Successful Target Target Info [5]
Amyloid beta A4 protein (APP) Successful Target Target Info [6]
Tumor necrosis factor (TNF) Successful Target Target Info [7]
Low-density lipoprotein receptor (LDL-R) Successful Target Target Info [8]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [9]
Interleukin-18 (IL18) Clinical trial Target Target Info [9]
Macrophage colony-stimulating factor 1 (CSF1) Clinical trial Target Target Info [10]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [8]
X-linked inhibitor of apoptosis protein (XIAP) Clinical trial Target Target Info [11]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [12]
Delta-like protein 4 (DLL4) Clinical trial Target Target Info [13]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [14]
Activin receptor-like kinase 2 (ALK-2) Clinical trial Target Target Info [15]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [5]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [16]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [17]
Autophagy-related 2B (ATG2B) Literature-reported Target Target Info [18]
Homeobox protein Hox-A5 (HOXA5) Literature-reported Target Target Info [10]
Methyl cpg binding protein 2 (MECP2) Clinical trial Target Target Info [19]
Runt-related transcription factor 3 (RUNX3) Literature-reported Target Target Info [20]
Protein(s) Regulated by This miRNA Ataxin-1 Regulated Protein
ATX1_HUMAN
[21]
Dynamin-2 Regulated Protein
DYN2_HUMAN
[5]
Homeobox protein Hox-A10 Regulated Protein
HXA10_HUMAN
[14]
Homeobox protein MOX-2 Regulated Protein
MEOX2_HUMAN
[24]
Interferon-induced transmembrane protein 1 Regulated Protein
IFM1_HUMAN
[25]
Mitogen-activated protein kinase kinase kinase 12 Regulated Protein
M3K12_HUMAN
[26]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[27]
Mothers against decapentaplegic homolog 5 Regulated Protein
SMAD5_HUMAN
[5]
Peroxisome proliferator-activated receptor gamma coactivator 1-alpha Regulated Protein
PRGC1_HUMAN
[28]
Protachykinin-1 Regulated Protein
TKN1_HUMAN
[29]
Ras-related protein Rab-5A Regulated Protein
RAB5A_HUMAN
[5]
Ras-related protein Rab-5A Regulated Protein
RAB5A_HUMAN
[30]
SLAIN motif-containing protein 1 Regulated Protein
SLAI1_HUMAN
[31]
Transcription factor MafB Regulated Protein
MAFB_HUMAN
[32]
References
REF 1 The hepatitis B virus-associated estrogen receptor alpha (ERalpha) was regulated by microRNA-130a in HepG2.2.15 human hepatocellular carcinoma cells. Acta Biochim Biophys Sin (Shanghai). 2011 Aug;43(8):640-6.
REF 2 The Etv2-miR-130a Network Regulates Mesodermal Specification. Cell Rep. 2015 Nov 3;13(5):915-23.
REF 3 Systems-level regulation of microRNA networks by miR-130/301 promotes pulmonary hypertension. J Clin Invest. 2014 Aug;124(8):3514-28.
REF 4 miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol Cell Biol. 2011 Feb;31(4):626-38.
REF 5 MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733.
REF 6 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 7 NF-B-modulated miR-130a targets TNF- in cervical cancer cells. J Transl Med. 2014 Jun 1;12:155.
REF 8 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 9 Reduced MIR130A is involved in primary immune thrombocytopenia via targeting TGFB1 and IL18. Br J Haematol. 2014 Sep;166(5):767-73.
REF 10 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 11 Downregulation of miR-130a contributes to cisplatin resistance in ovarian cancer cells by targeting X-linked inhibitor of apoptosis (XIAP) directly. Acta Biochim Biophys Sin (Shanghai). 2013 Dec;45(12):995-1001.
REF 12 Downregulation of connexin43 by microRNA-130a in cardiomyocytes results in cardiac arrhythmias. J Mol Cell Cardiol. 2014 Sep;74:53-63.
REF 13 MicroRNA-30a promotes chondrogenic differentiation of mesenchymal stem cells through inhibiting Delta-like 4 expression. Life Sci. 2016 Mar 1;148:220-8.
REF 14 Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11.
REF 15 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 16 Nuclear factor-B-dependent microRNA-130a upregulation promotes cervical cancer cell growth by targeting phosphatase and tensin homolog. Arch Biochem Biophys. 2016 May 15;598:57-65.
REF 17 MicroRNA-130a associates with ribosomal protein L11 to suppress c-Myc expression in response to UV irradiation. Oncotarget. 2015 Jan 20;6(2):1101-14.
REF 18 miRNA-130a targets ATG2B and DICER1 to inhibit autophagy and trigger killing of chronic lymphocytic leukemia cells. Cancer Res. 2012 Apr 1;72(7):1763-72.
REF 19 MiR-130a regulates neurite outgrowth and dendritic spine density by targeting MeCP2. Protein Cell. 2016 Jul;7(7):489-500.
REF 20 Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun. 2012 Aug 24;425(2):468-72.
REF 21 miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis.Nat Neurosci. 2008 Oct;11(10):1137-9.
REF 22 MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733.
REF 23 Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11.
REF 24 Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood. 2008 Feb 1;111(3):1217-26.
REF 25 Hepatitis C virus infection modulates expression of interferon stimulatory gene IFITM1 by upregulating miR-130A.J Virol. 2012 Sep;86(18):10221-5.
REF 26 MicroRNA-130a Targets MAP3K12 to Modulate Diabetic Endothelial Progenitor Cell Function.Cell Physiol Biochem. 2015;36(2):712-26.
REF 27 MiR-130a-3p regulates cell migration and invasion via inhibition of Smad4 in gemcitabine resistant hepatoma cells.J Exp Clin Cancer Res. 2016 Jan 27;35:19.
REF 28 MicroRNA-130a can inhibit hepatitis B virus replication via targeting PGC1 and PPAR.RNA. 2015 Mar;21(3):385-400.
REF 29 MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells.Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15484-9.
REF 30 MicroRNA-130a inhibits cell proliferation, invasion and migration in human breast cancer by targeting the RAB5A. Int J Clin Exp Pathol. 2015 Jan 1;8(1):384-93.
REF 31 miR-130a activates apoptotic signaling through activation of caspase-8 in taxane-resistant prostate cancer cells.Prostate. 2015 Oct;75(14):1568-78.
REF 32 MicroRNA fingerprints during human megakaryocytopoiesis.Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.