Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T20953 |
Target Info
|
| Target Name |
BUB1 mitotic checkpoint serine/threonine kinase (BUB1) |
| Synonyms |
hBUB1; Mitotic checkpoint serine/threonine-protein kinase BUB1; BUB1L; BUB1A |
| Target Type |
Patented-recorded Target |
| Gene Name |
BUB1 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-10b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acagauucgauucuaggggaau
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The transfection with an inhibitor of miR-10b activity in untransformed MCF10A cells leads to an increase of BUB1. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunoblot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
BUB1 mitotic checkpoint serine/threonine kinase (BUB1)
|
Target Info
|
|
|
Cyclin A2 (CCNA2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-450a-1-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
auugggaacauuuugcauguau
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-450a-3p is confirmed to directly target Bub1. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
BUB1 mitotic checkpoint serine/threonine kinase (BUB1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The locus of microRNA-10b: a critical target for breast cancer insurgence and dissemination. Cell Cycle. 2013 Aug 1;12(15):2371-5.
|
| REF 2 |
miR-10b*, a master inhibitor of the cell cycle, is down-regulated in human breast tumours. EMBO Mol Med. 2012 Nov;4(11):1214-29.
|
| REF 3 |
MicroRNA-450a-3p represses cell proliferation and regulates embryo development by regulating Bub1 expression in mouse. PLoS One. 2012;7(10):e47914.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
