Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T25956 | Target Info | |||
| Target Name | Histone acetyltransferase p300 (EP300) | ||||
| Synonyms | p300 HAT; Protein propionyltransferase p300; P300; Histone crotonyltransferase p300; Histone butyryltransferase p300; E1Aassociated protein p300; E1A-associated protein p300 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | EP300 | ||||
| Biochemical Class | Acyltransferase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-150-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucucccaacccuuguaccagug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-150 regulates p300 expression through its 3-UTR. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
| Beta-arrestin-2 (ARRB2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-574-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cacgcucaugcacacacccaca | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-574-3p decreased the relative luciferase activities of EP300. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
| Histone acetyltransferase p300 (EP300) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | miR-150 regulates high glucose-induced cardiomyocyte hypertrophy by targeting the transcriptional co-activator p300. Exp Cell Res. 2013 Feb 1;319(3):173-84. | ||||
| REF 2 | Wnt/-catenin pathway transactivates microRNA-150 that promotes EMT of colorectal cancer cells by suppressing CREB signaling. Oncotarget. 2016 Jul 5;7(27):42513-42526. | ||||
| REF 3 | Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.