Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25956 Target Info
Target Name Histone acetyltransferase p300 (EP300)
Synonyms p300 HAT; Protein propionyltransferase p300; P300; Histone crotonyltransferase p300; Histone butyryltransferase p300; E1Aassociated protein p300; E1A-associated protein p300
Target Type Clinical trial Target
Gene Name EP300
Biochemical Class Acyltransferase
UniProt ID
Q09472
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism miR-150 regulates p300 expression through its 3-UTR. [1]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-574-3p miRNA Info
miRNA Mature AC
MIMAT0003239
Sequence cacgcucaugcacacacccaca
miRNA Species Homo sapiens
Regulation Mechanism miR-574-3p decreased the relative luciferase activities of EP300. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Histone acetyltransferase p300 (EP300) Target Info
EP300_HUMAN
References  Top
REF 1 miR-150 regulates high glucose-induced cardiomyocyte hypertrophy by targeting the transcriptional co-activator p300. Exp Cell Res. 2013 Feb 1;319(3):173-84.
REF 2 Wnt/-catenin pathway transactivates microRNA-150 that promotes EMT of colorectal cancer cells by suppressing CREB signaling. Oncotarget. 2016 Jul 5;7(27):42513-42526.
REF 3 Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.