Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T27297 | Target Info | |||
| Target Name | Proto-oncogene c-Crk (c-Crk) | ||||
| Synonyms | P38; Adapter molecule crk | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | CRK | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-126-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucguaccgugaguaauaaugcg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-126 expression resulted in a clear decrease in Crk expression. | [5] | |||
| Evidence Score (E-score) | 5 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot; qRT-PCR | [2] | |||
| 3 | qRT-PCR; Western Blot | [3] | |||
| 4 | qRT-PCR; Western Blot | [4] | |||
| 5 | Western Blot | [5] | |||
| Representative Target(s) Regulated by This miRNA | Adrenomedullin (ADM) | Target Info | |||
| Angiopoietin 1 receptor (TEK) | Target Info | ||||
| miRNA Mature ID | hsa-miR-132-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaacagucuacagccauggucg | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [6] | |||
| 2 | Microarray | [7] | |||
| Representative Target(s) Regulated by This miRNA | Brain-derived neurotrophic factor (BDNF) | Target Info | |||
| Cyclin A2 (CCNA2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-126-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cauuauuacuuuugguacgcg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | CRK is validated to be the target of miR-126 in HSC. | [8] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | ELISA; Luciferase Reporter Assay; Western Blot | [8] | |||
| Representative Target(s) Regulated by This miRNA | Matrix metalloproteinase-7 (MMP-7) | Target Info | |||
| Proto-oncogene c-Crk (c-Crk) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | miR-126 functions as a tumour suppressor in human gastric cancer. Cancer Lett. 2010 Dec 1;298(1):50-63. | ||||
| REF 2 | MicroRNA-126 inhibits invasion in non-small cell lung carcinoma cell lines. Biochem Biophys Res Commun. 2008 Sep 5;373(4):607-12. | ||||
| REF 3 | MiR-126 inhibits the invasion of gastric cancer cell in part by targeting Crk. Eur Rev Med Pharmacol Sci. 2014;18(14):2031-7. | ||||
| REF 4 | Mir-126 inhibits growth of SGC-7901 cells by synergistically targeting the oncogenes PI3KR2 and Crk, and the tumor suppressor PLK2. Int J Oncol. 2014 Sep;45(3):1257-65. | ||||
| REF 5 | Regulation of miRNA expression by Src and contact normalization: effects on nonanchored cell growth and migration. Oncogene. 2009 Dec 3;28(48):4272-83. | ||||
| REF 6 | Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach. Proc Natl Acad Sci U S A. 2012 Dec 11;109(50):20473-8. | ||||
| REF 7 | MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105. | ||||
| REF 8 | Overexpression of miR-126 inhibits the activation and migration of HSCs through targeting CRK. Cell Physiol Biochem. 2014;33(1):97-106. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.