Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T31721 |
Target Info
|
| Target Name |
Excitatory amino acid transporter 3 (SLC1A1) |
| Synonyms |
Solute carrier family 1 member 1; Sodium-dependent glutamate/aspartate transporter 3; Neuronal and epithelial glutamate transporter; Excitatory amino-acid carrier 1; EAAT3; EAAC1 |
| Target Type |
Literature-reported Target |
| Gene Name |
SLC1A1 |
| Biochemical Class |
Dicarboxylate/amino acid:cation symporter |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuuggcacuagcacauuuuugcu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Significant decrease in luciferase activity was found when the 3'UTR of SLC1A1 was transfected with human or mouse miR-96, whereas transfection with the negative control (scrambled miR-96) had no effect on luciferase activity. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
