Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T35173 |
Target Info
|
| Target Name |
Cellular inhibitor of apoptosis 2 (BIRC3) |
| Synonyms |
hIAP1; hIAP-1; TNFR2TRAFsignaling complex protein 1; TNFR2-TRAF-signaling complex protein 1; RNF49; RING-type E3 ubiquitin transferase BIRC3; RING finger protein 49; MIHC; Inhibitor of apoptosis protein 1; IAP1; IAP homolog C; CIAP2; C-IAP2; Baculoviral IAP repeatcontaining protein3; Baculoviral IAP repeat-containing protein 3; Apoptosis inhibitor 2; API2 |
| Target Type |
Clinical trial Target |
| Gene Name |
BIRC3 |
| Biochemical Class |
Acyltransferase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Northern Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 Jun 8;26(5):745-52.
|
| REF 2 |
MicroRNA-34a inhibits tumor invasion and metastasis in osteosarcoma partly by effecting C-IAP2 and Bcl-2. Tumour Biol. 2017 Jun;39(6):1010428317705761.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
