miRNA General Information
miRNA Mature ID	hsa-miR-34a-5p
miRNA Stemloop AC	MI0000268
miRNA Stemloop ID	hsa-mir-34a
Sequence	uggcagugucuuagcugguugu
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
	Histone deacetylase 1 (HDAC1)	Successful Target	Target Info	[2]
	Platelet-derived growth factor receptor alpha (PDGFRA)	Successful Target	Target Info	[3]
	Proto-oncogene c-Src (SRC)	Successful Target	Target Info	[4]
	Tyrosine-protein kinase Kit (KIT)	Successful Target	Target Info	[5]
	Androgen receptor (AR)	Successful Target	Target Info	[6]
	Angiotensin II receptor type-1 (AGTR1)	Successful Target	Target Info	[7]
	Cyclin-dependent kinase 4 (CDK4)	Successful Target	Target Info	[8]
	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[9]
	Matrix metalloproteinase-7 (MMP-7)	Successful Target	Target Info	[10]
	Peroxisome proliferator-activated receptor alpha (PPARA)	Successful Target	Target Info	[11]
	PI3-kinase gamma (PIK3CG)	Successful Target	Target Info	[12]
	Platelet-derived growth factor receptor beta (PDGFRB)	Successful Target	Target Info	[13]
	Proto-oncogene c-Met (MET)	Successful Target	Target Info	[14]
	Apoptosis regulator Bcl-2 (BCL-2)	Successful Target	Target Info	[15]
	Inosine-5'-monophosphate dehydrogenase 2 (IMPDH2)	Successful Target	Target Info	[16]
	Tyrosine-protein kinase UFO (AXL)	Successful Target	Target Info	[2]
	Voltage-gated potassium channel Kv11.1 (KCNH2)	Successful Target	Target Info	[17]
	Interferon-beta (IFNB1)	Successful Target	Target Info	[18]
	Vascular endothelial growth factor A (VEGFA)	Successful Target	Target Info	[19]
	ERK activator kinase 1 (MEK1)	Clinical trial Target	Target Info	[20]
	RAC-alpha serine/threonine-protein kinase (AKT1)	Successful Target	Target Info	[12]
	Mixed lineage kinase 1 (MAP3K9)	Clinical trial Target	Target Info	[21]
	NAD-dependent deacetylase sirtuin-1 (SIRT1)	Clinical trial Target	Target Info	[22]
	Apoptosis inhibitor survivin (BIRC5)	Clinical trial Target	Target Info	[23]
	Cellular tumor antigen p53 (TP53)	Clinical trial Target	Target Info	[24]
	Growth/differentiation factor 5 (GDF-5)	Clinical trial Target	Target Info	[25]
	Nicotinamide phosphoribosyltransferase (NAMPT)	Clinical trial Target	Target Info	[26]
	Cellular inhibitor of apoptosis 2 (BIRC3)	Clinical trial Target	Target Info	[27]
	G1/S-specific cyclin-D1 (CCND1)	Clinical trial Target	Target Info	[28]
	Notch-1 receptor (NOTCH1)	Clinical trial Target	Target Info	[29]
	Notch-2 receptor (NOTCH2)	Clinical trial Target	Target Info	[30]
	Beta-klotho (KLB)	Clinical trial Target	Target Info	[31]
	E2F transcription factor 1 (E2F1)	Clinical trial Target	Target Info	[32]
	Extracellular matrix receptor III (CD44)	Clinical trial Target	Target Info	[33]
	Melanoma-associated antigen 3 (MAGEA3)	Clinical trial Target	Target Info	[34]
	GDNF receptor alpha-3 (GFRA3)	Clinical trial Target	Target Info	[35]
	Kruppel like factor 4 (KLF4)	Clinical trial Target	Target Info	[36]
	Colony stimulating factor-1 receptor (CSF-1R)	Clinical trial Target	Target Info	[37]
	Lysine-specific demethylase 4A (KDM4A)	Patented-recorded Target	Target Info	[38]
	M-phase inducer phosphatase 1 (MPIP1)	Literature-reported Target	Target Info	[39]
	Metabotropic glutamate receptor 7 (mGluR7)	Literature-reported Target	Target Info	[40]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[41]
	Tyrosine-protein kinase ZAP-70 (ZAP-70)	Patented-recorded Target	Target Info	[42]
	Ephrin type-A receptor 5 (EPHA5)	Literature-reported Target	Target Info	[43]
	Hepatocyte nuclear factor 4-alpha (HNF4A)	Literature-reported Target	Target Info	[44]
	Lactate dehydrogenase A (LDHA)	Literature-reported Target	Target Info	[2]
	NADPH oxidase 2 (CYBB)	Literature-reported Target	Target Info	[45]
	Protein kinase D (PRKD1)	Literature-reported Target	Target Info	[46]
	Serine/threonine-protein kinase NIK (MAP3K14)	Literature-reported Target	Target Info	[47]
	CCAAT/enhancer binding protein beta (CEBPB)	Literature-reported Target	Target Info	[48]
	DNA repair protein RAD51 homolog 1 (RAD51)	Clinical trial Target	Target Info	[49]
	High mobility group protein B1 (HMGB1)	Literature-reported Target	Target Info	[50]
	Orphan nuclear receptor NURR1 (NR4A2)	Literature-reported Target	Target Info	[51]
	Proto-oncogene c-Fos (c-Fos)	Literature-reported Target	Target Info	[52]
	Voltage-gated potassium channel Kv10.1 (KCNH1)	Literature-reported Target	Target Info	[53]
	Amphiregulin (AREG)	Literature-reported Target	Target Info	[54]
	Autophagy-related protein 7 (ATG7)	Literature-reported Target	Target Info	[55]
	Beclin-1 (BECN1)	Literature-reported Target	Target Info	[55]
	CDK inhibitor 4C p18-INK4c (CDKN2C)	Literature-reported Target	Target Info	[56]
	Cyclin D (CCND3)	Literature-reported Target	Target Info	[39]
	Fos-related antigen 1 (FOSL1)	Literature-reported Target	Target Info	[57]
	Macrophage-derived chemokine (MDC)	Literature-reported Target	Target Info	[58]
	MTOR complex 2 (RICTOR)	Literature-reported Target	Target Info	[59]
Multiple tumor suppressor 1 (CDKN2A)	Literature-reported Target	Target Info	[56]
N-myc proto-oncogene protein (MYCN)	Literature-reported Target	Target Info	[29]
Transcription factor SOX-2 (SOX2)	Literature-reported Target	Target Info	[60]
CREB-regulated transcription coactivator 1 (TORC1)	Clinical trial Target	Target Info	[61]
G1/S-specific cyclin-E2 (CCNE2)	Literature-reported Target	Target Info	[8]
Melanoma-associated antigen 2 (MAGEA2)	Literature-reported Target	Target Info	[34]
Small cell lung carcinoma cluster 4 antigen (CD24)	Literature-reported Target	Target Info	[4]
Stathmin-1 (STMN1)	Literature-reported Target	Target Info	[62]
Protein(s) Regulated by This miRNA	Actin-binding LIM protein 1	Regulated Protein	ABLM1_HUMAN	[54]
	Activator of apoptosis harakiri	Regulated Protein	HRK_HUMAN	[64]
	AH receptor-interacting protein	Regulated Protein	AIP_HUMAN	[65]
	Alpha-(1,6)-fucosyltransferase	Regulated Protein	FUT8_HUMAN	[66]
	Ankyrin-3	Regulated Protein	ANK3_HUMAN	[67]
	Apoptosis regulator BAX	Regulated Protein	BAX_HUMAN	[68]
	Apoptosis-inducing factor 1, mitochondrial	Regulated Protein	AIFM1_HUMAN	[64]
	Apoptosis-stimulating of p53 protein 2	Regulated Protein	ASPP2_HUMAN	[64]
	Apoptotic protease-activating factor 1	Regulated Protein	APAF_HUMAN	[64]
	Astrocytic phosphoprotein PEA-15	Regulated Protein	PEA15_HUMAN	[54]
	ATP synthase subunit s, mitochondrial	Regulated Protein	ATP5S_HUMAN	[69]
	Autophagy protein 5	Regulated Protein	ATG5_HUMAN	[55]
	Axin-2	Regulated Protein	AXIN2_HUMAN	[71]
	B-cell lymphoma/leukemia 10	Regulated Protein	BCL10_HUMAN	[64]
	Baculoviral IAP repeat-containing protein 1	Regulated Protein	BIRC1_HUMAN	[64]
	Baculoviral IAP repeat-containing protein 6	Regulated Protein	BIRC6_HUMAN	[64]
	BAG family molecular chaperone regulator 1	Regulated Protein	BAG1_HUMAN	[64]
	BAG family molecular chaperone regulator 3	Regulated Protein	BAG3_HUMAN	[64]
	Bcl-2-interacting killer	Regulated Protein	BIK_HUMAN	[64]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[64]
	Bcl-2-related protein A1	Regulated Protein	B2LA1_HUMAN	[64]
	BCL2/adenovirus E1B 19 kDa protein-interacting protein 2	Regulated Protein	BNIP2_HUMAN	[64]
	BCL2/adenovirus E1B 19 kDa protein-interacting protein 3	Regulated Protein	BNIP3_HUMAN	[64]
	Beta-1,4-galactosyltransferase 5	Regulated Protein	B4GT5_HUMAN	[54]
	Beta/gamma crystallin domain-containing protein 1	Regulated Protein	CRBG1_HUMAN	[54]
	Bifunctional apoptosis regulator	Regulated Protein	BFAR_HUMAN	[64]
	Bone morphogenetic protein 7	Regulated Protein	BMP7_HUMAN	[72]
	Calcipressin-1	Regulated Protein	RCAN1_HUMAN	[73]
	Caspase-14	Regulated Protein	CASPE_HUMAN	[64]
	Cell death activator CIDE-A	Regulated Protein	CIDEA_HUMAN	[64]
	Cell death activator CIDE-B	Regulated Protein	CIDEB_HUMAN	[64]
	Circadian locomoter output cycles protein kaput	Regulated Protein	CLOCK_HUMAN	[54]
	Cysteine protease ATG4A	Regulated Protein	ATG4A_HUMAN	[55]
	Cysteine protease ATG4B	Regulated Protein	ATG4B_HUMAN	[55]
	Cysteine protease ATG4B	Regulated Protein	ATG4B_HUMAN	[74]
	Cysteine protease ATG4C	Regulated Protein	ATG4C_HUMAN	[55]
	Cysteine protease ATG4D	Regulated Protein	ATG4D_HUMAN	[55]
	Cytochrome c	Regulated Protein	CYC_HUMAN	[64]
	Death domain-containing protein CRADD	Regulated Protein	CRADD_HUMAN	[64]
	Death-associated protein kinase 1	Regulated Protein	DAPK1_HUMAN	[64]
	Dedicator of cytokinesis protein 3	Regulated Protein	DOCK3_HUMAN	[54]
	Delta-like protein 1	Regulated Protein	DLL1_HUMAN	[29]
	Deoxyguanosine kinase, mitochondrial	Regulated Protein	DGUOK_HUMAN	[76]
	E3 ubiquitin-protein ligase RNF169	Regulated Protein	RN169_HUMAN	[54]
	Epithelial membrane protein 1	Regulated Protein	EMP1_HUMAN	[27]
	FERM domain-containing protein 4A	Regulated Protein	FRM4A_HUMAN	[47]
	Flotillin-2	Regulated Protein	FLOT2_HUMAN	[79]
	Forkhead box protein P1	Regulated Protein	FOXP1_HUMAN	[48]
	Forkhead box protein P1	Regulated Protein	FOXP1_HUMAN	[81]
	Growth arrest and DNA damage-inducible protein GADD45 alpha	Regulated Protein	GA45A_HUMAN	[64]
	Growth arrest-specific protein 1	Regulated Protein	GAS1_HUMAN	[82]
	Hepatocyte nuclear factor 4-gamma	Regulated Protein	HNF4G_HUMAN	[83]
	Homeobox protein NANOG	Regulated Protein	NANOG_HUMAN	[60]
	Homeobox protein TGIF2	Regulated Protein	TGIF2_HUMAN	[85]
	Hypoxanthine-guanine phosphoribosyltransferase	Regulated Protein	HPRT_HUMAN	[86]
	Inhibin beta B chain	Regulated Protein	INHBB_HUMAN	[87]
	Inositol monophosphatase 1	Regulated Protein	IMPA1_HUMAN	[16]
	Insulin-like growth factor 2 mRNA-binding protein 3	Regulated Protein	IF2B3_HUMAN	[89]
	Interleukin-6 receptor subunit alpha	Regulated Protein	IL6RA_HUMAN	[90]
	Krueppel-like factor 12	Regulated Protein	KLF12_HUMAN	[91]
	Long-chain-fatty-acid--CoA ligase 1	Regulated Protein	ACSL1_HUMAN	[2]
	Lymphoid enhancer-binding factor 1	Regulated Protein	LEF1_HUMAN	[2]
	Melanoma-associated antigen 12	Regulated Protein	MAGAC_HUMAN	[34]
	Melanoma-associated antigen 6	Regulated Protein	MAGA6_HUMAN	[34]
Metastasis-associated protein MTA2	Regulated Protein	MTA2_HUMAN	[44]
Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[95]
Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[96]
N-acetylgalactosaminyltransferase 7	Regulated Protein	GALT7_HUMAN	[97]
NAD-dependent protein deacetylase sirtuin-6	Regulated Protein	SIR6_HUMAN	[98]
NAD-dependent protein deacetylase sirtuin-7	Regulated Protein	SIR7_HUMAN	[99]
Neural cell adhesion molecule L1	Regulated Protein	L1CAM_HUMAN	[100]
Nuclear receptor coactivator 1	Regulated Protein	NCOA1_HUMAN	[54]
Nucleolar protein 3	Regulated Protein	NOL3_HUMAN	[64]
Peptidyl-glycine alpha-amidating monooxygenase	Regulated Protein	AMD_HUMAN	[101]
Peptidyl-prolyl cis-trans isomerase FKBP1B	Regulated Protein	FKB1B_HUMAN	[102]
Period circadian protein homolog 1	Regulated Protein	PER1_HUMAN	[47]
Poly(rC)-binding protein 2	Regulated Protein	PCBP2_HUMAN	[103]
POU domain, class 5, transcription factor 1	Regulated Protein	PO5F1_HUMAN	[104]
Protein jagged-1	Regulated Protein	JAG1_HUMAN	[105]
Protein Mdm4	Regulated Protein	MDM4_HUMAN	[106]
Protein NLRC5	Regulated Protein	NLRC5_HUMAN	[107]
Protein numb homolog	Regulated Protein	NUMB_HUMAN	[108]
Protein S100-P	Regulated Protein	S100P_HUMAN	[109]
Proto-oncogene Wnt-1	Regulated Protein	WNT1_HUMAN	[71]
Retinol-binding protein 2	Regulated Protein	RET2_HUMAN	[110]
Rho GDP-dissociation inhibitor 2	Regulated Protein	GDIR2_HUMAN	[111]
Serine/threonine-protein phosphatase 1 regulatory subunit 10	Regulated Protein	PP1RA_HUMAN	[112]
Serine/threonine-protein phosphatase PP1-gamma catalytic subunit	Regulated Protein	PP1G_HUMAN	[113]
Synaptotagmin-1	Regulated Protein	SYT1_HUMAN	[114]
Syntaxin-1A	Regulated Protein	STX1A_HUMAN	[114]
Target of Myb protein 1	Regulated Protein	TOM1_HUMAN	[54]
TNF receptor-associated factor 2	Regulated Protein	TRAF2_HUMAN	[64]
TNF receptor-associated factor 3	Regulated Protein	TRAF3_HUMAN	[64]
Transcription factor 7	Regulated Protein	TCF7_HUMAN	[115]
Transcription factor PU.1	Regulated Protein	SPI1_HUMAN	[48]
Transcriptional repressor protein YY1	Regulated Protein	TYY1_HUMAN	[116]
Triggering receptor expressed on myeloid cells 2	Regulated Protein	TREM2_HUMAN	[117]
Tumor necrosis factor receptor superfamily member 21	Regulated Protein	TNR21_HUMAN	[64]
Tumor necrosis factor receptor superfamily member 6B	Regulated Protein	TNF6B_HUMAN	[27]
Tumor protein p73	Regulated Protein	P73_HUMAN	[64]
UL16-binding protein 2	Regulated Protein	ULBP2_HUMAN	[118]
Vesicle-associated membrane protein 2	Regulated Protein	VAMP2_HUMAN	[29]
Voltage-dependent L-type calcium channel subunit beta-3	Regulated Protein	CACB3_HUMAN	[67]
Zinc finger protein SNAI1	Regulated Protein	SNAI1_HUMAN	[119]
References
REF 1	MiR-34a modulates ErbB2 in breast cancer. Cell Biol Int. 2017 Jan;41(1):93-101.
REF 2	Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 3	miR-34a repression in proneural malignant gliomas upregulates expression of its target PDGFRA and promotes tumorigenesis. PLoS One. 2012;7(3):e33844.
REF 4	CD24 induces expression of the oncomir miR-21 via Src, and CD24 and Src are both post-transcriptionally downregulated by the tumor suppressor miR-34a. PLoS One. 2013;8(3):e59563.
REF 5	MiR-34a-5p promotes the multi-drug resistance of osteosarcoma by targeting the CD117 gene. Oncotarget. 2016 May 10;7(19):28420-34.
REF 6	Inactivation of AR and Notch-1 signaling by miR-34a attenuates prostate cancer aggressiveness. Am J Transl Res. 2012;4(4):432-42.
REF 7	The miR-34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. BMC Cancer. 2017 Jan 10;17(1):45.
REF 8	microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 9	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 10	MiRNA-34a inhibits EGFR-signaling-dependent MMP7 activation in gastric cancer. Tumour Biol. 2014 Oct;35(10):9801-6.
REF 11	Effect of miR-34a in regulating steatosis by targeting PPAR expression in nonalcoholic fatty liver disease. Sci Rep. 2015 Sep 2;5:13729.
REF 12	Upregulation of miR-34a by diallyl disulfide suppresses invasion and induces apoptosis in SGC-7901 cells through inhibition of the PI3K/Akt signali... Oncol Lett. 2016 Apr;11(4):2661-2667.
REF 13	MiR-34a/c-Dependent PDGFR-/ Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer. PLoS One. 2013 Jun 21;8(6):e67581.
REF 14	Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 15	miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 16	A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH. Biochem Biophys Res Commun. 2012 Feb 24;418(4):682-8.
REF 17	MiR-133b contributes to arsenic-induced apoptosis in U251 glioma cells by targeting the hERG channel. J Mol Neurosci. 2015 Apr;55(4):985-94.
REF 18	MicroRNA regulation of IFN-beta protein expression: rapid and sensitive modulation of the innate immune response. J Immunol. 2010 Mar 1;184(5):2369-76.
REF 19	The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 20	MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 21	MicroRNA-34a is a potent tumor suppressor molecule in vivo in neuroblastoma. BMC Cancer. 2011 Jan 25;11:33.
REF 22	miR-34a repression of SIRT1 regulates apoptosis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13421-6.
REF 23	Expression and regulatory function of miRNA-34a in targeting survivin in gastric cancer cells. Tumour Biol. 2013 Apr;34(2):963-71.
REF 24	Downregulation of miR-34a in breast tumors is not associated with either p53 mutations or promoter hypermethylation while it correlates with metastasis. Med Oncol. 2013 Mar;30(1):413.
REF 25	Inhibition of microRNA-34a prevents IL-1-induced extracellular matrix degradation in nucleus pulposus by increasing GDF5 expression. Exp Biol Med (Maywood). 2016 Nov;241(17):1924-1932.
REF 26	Elevated microRNA-34a in obesity reduces NAD+ levels and SIRT1 activity by directly targeting NAMPT. Aging Cell. 2013 Dec;12(6):1062-72.
REF 27	Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 Jun 8;26(5):745-52.
REF 28	MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 29	Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 30	MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 31	Aberrantly elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor -Klotho. Proc Natl Acad Sci U S A. 2012 Oct 2;109(40):16137-42.
REF 32	Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15472-7.
REF 33	The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10.
REF 34	miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.
REF 35	Identification of targets of tumor suppressor microRNA-34a using a reporter library system. Proc Natl Acad Sci U S A. 2017 Apr 11;114(15):3927-3932.
REF 36	MiR-34a regulates apoptosis in liver cells by targeting the KLF4 gene. Cell Mol Biol Lett. 2014 Mar;19(1):52-64.
REF 37	MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells. Front Immunol. 2013 Oct 30;4:353.
REF 38	JMJD2A predicts prognosis and regulates cell growth in human gastric cancer. Biochem Biophys Res Commun. 2014 Jun 20;449(1):1-7.
REF 39	Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 40	MicroRNAs in psychiatric and neurodevelopmental disorders. Brain Res. 2010 Jun 18;1338:78-88.
REF 41	Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 42	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 43	MicroRNA-34a regulates migration of chondroblast and IL-1-induced degeneration of chondrocytes by targeting EphA5. Biochem Biophys Res Commun. 2011 Dec 2;415(4):551-7.
REF 44	MicroRNAs regulate human hepatocyte nuclear factor 4alpha, modulating the expression of metabolic enzymes and cell cycle. J Biol Chem. 2010 Feb 12;285(7):4415-22.
REF 45	MicroRNA-34a induces apoptosis in the human glioma cell line, A172, through enhanced ROS production and NOX2 expression. Biochem Biophys Res Commun. 2014 Jan 31;444(1):6-12.
REF 46	A novel miR-34a target, protein kinase D1, stimulates cancer stemness and drug resistance through GSK3/-catenin signaling in breast cancer. Oncotarget. 2016 Mar 22;7(12):14791-802.
REF 47	Differential expression of microRNA in endothelial cells incubated with serum of hypertension patients with blood-stasis syndrome. Chin J Integr Med. 2015 Nov;21(11):817-22.
REF 48	MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 49	In Vivo Delivery of miR-34a Sensitizes Lung Tumors to Radiation Through RAD51 Regulation. Mol Ther Nucleic Acids. 2015 Dec 15;4:e270.
REF 50	Downregulation of HMGB1 by miR-34a is sufficient to suppress proliferation, migration and invasion of human cervical and colorectal cancer cells. Tumour Biol. 2016 Oct;37(10):13155-13166.
REF 51	Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102.
REF 52	Reduction of c-Fos via Overexpression of miR-34a Results in Enhancement of TNF- Production by LPS in Neutrophils from Myelodysplastic Syndrome Patients. PLoS One. 2016 Aug 11;11(8):e0158527.
REF 53	MicroRNA-34a inhibits human osteosarcoma proliferation by downregulating ether go-go 1 expression. Int J Med Sci. 2013;10(6):676-82.
REF 54	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 55	Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 56	Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.
REF 57	MicroRNA-34a inhibits migration and invasion of colon cancer cells via targeting to Fra-1. Carcinogenesis. 2012 Mar;33(3):519-28.
REF 58	TGF--miR-34a-CCL22 signaling-induced Treg cell recruitment promotes venous metastases of HBV-positive hepatocellular carcinoma. Cancer Cell. 2012 Sep 11;22(3):291-303.
REF 59	Tumor suppressive miRNA-34a suppresses cell proliferation and tumor growth of glioma stem cells by targeting Akt and Wnt signaling pathways. FEBS Open Bio. 2014 May 22;4:485-95.
REF 60	miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 61	The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation. Sci Rep. 2016 Nov 21;6:37280.
REF 62	The Microtubule Network and Cell Death Are Regulated by an miR-34a/Stathmin 1/III-Tubulin Axis. Mol Cancer Res. 2017 Jul;15(7):953-964.
REF 63	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 64	miR-34a: Multiple Opposing Targets and One Destiny in Hepatocellular Carcinoma.J Clin Transl Hepatol. 2016 Dec 28;4(4):300-305.
REF 65	Regulation of aryl hydrocarbon receptor interacting protein (AIP) protein expression by MiR-34a in sporadic somatotropinomas.PLoS One. 2015 Feb 6;10(2):e0117107.
REF 66	Effects of microRNAs on fucosyltransferase 8 (FUT8) expression in hepatocarcinoma cells.PLoS One. 2013 Oct 9;8(10):e76540.
REF 67	Dysregulation of miR-34a links neuronal development to genetic risk factors for bipolar disorder.Mol Psychiatry. 2015 May;20(5):573-84.
REF 68	MicroRNA 34a contributes to virus-mediated apoptosis through binding to its target gene Bax in influenza A virus infection.Biomed Pharmacother. 2016 Oct;83:1464-1470.
REF 69	MiR-34a is Involved in the Decrease of ATP Contents Induced by Resistin Through Target on ATP5S in HepG2 Cells.Biochem Genet. 2015 Dec;53(11-12):301-9.
REF 70	Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 71	New class of microRNA targets containing simultaneous 5'-UTR and 3'-UTR interaction sites.Genome Res. 2009 Jul;19(7):1175-83.
REF 72	microRNA miR-34a regulates cytodifferentiation and targets multi-signaling pathways in human dental papilla cells. PLoS One. 2012;7(11):e50090.
REF 73	MicroRNA-34a targets regulator of calcineurin 1 to modulate endothelial inflammation after fetal cardiac bypass in goat placenta.Placenta. 2017 Mar;51:49-56.
REF 74	Methylation-induced silencing of miR-34a enhances chemoresistance by directly upregulating ATG4B-induced autophagy through AMPK/mTOR pathway in prostate cancer.Oncol Rep. 2016 Jan;35(1):64-72.
REF 75	Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 76	MicroRNA-34a enhances T cell activation by targeting diacylglycerol kinase .PLoS One. 2013 Oct 17;8(10):e77983.
REF 77	Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 Jun 8;26(5):745-52.
REF 78	Differential expression of microRNA in endothelial cells incubated with serum of hypertension patients with blood-stasis syndrome. Chin J Integr Med. 2015 Nov;21(11):817-22.
REF 79	Identification of FLOT2 as a novel target for microRNA-34a in melanoma.J Cancer Res Clin Oncol. 2015 Jun;141(6):993-1006.
REF 80	MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 81	Myc-mediated repression of microRNA-34a promotes high-grade transformation of B-cell lymphoma by dysregulation of FoxP1.Blood. 2011 Jun 9;117(23):6227-36.
REF 82	MiR-34a targets GAS1 to promote cell proliferation and inhibit apoptosis in papillary thyroid carcinoma via PI3K/Akt/Bad pathway.Biochem Biophys Res Commun. 2013 Nov 29;441(4):958-63.
REF 83	miR-34a inhibits proliferation and invasion of bladder cancer cells by targeting orphan nuclear receptor HNF4G.Dis Markers. 2015;2015:879254.
REF 84	miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 85	MicroRNA-34a inhibits tumor invasion and metastasis in gastric cancer by targeting Tgif2. Int J Clin Exp Pathol. 2015 Aug 1;8(8):8921-8.
REF 86	p53-independent upregulation of miR-34a during oncogene-induced senescence represses MYC. Cell Death Differ. 2010 Feb;17(2):236-45.
REF 87	miR-34a targets the inhibin beta B gene, promoting granulosa cell apoptosis in the porcine ovary.Genet Mol Res. 2014 Jan 14;13(2):2504-12.
REF 88	A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH. Biochem Biophys Res Commun. 2012 Feb 24;418(4):682-8.
REF 89	IGF2BP3 functions as a potential oncogene and is a crucial target of miR-34a in gastric carcinogenesis.Mol Cancer. 2017 Apr 11;16(1):77.
REF 90	IL-6R/STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis.J Clin Invest. 2014 Apr;124(4):1853-67.
REF 91	p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses. Mol Cell Proteomics. 2015 Oct;14(10):2609-29.
REF 92	Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 93	miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.
REF 94	MicroRNAs regulate human hepatocyte nuclear factor 4alpha, modulating the expression of metabolic enzymes and cell cycle. J Biol Chem. 2010 Feb 12;285(7):4415-22.
REF 95	microRNA-34a inhibits epithelial mesenchymal transition in human cholangiocarcinoma by targeting Smad4 through transforming growth factor-beta/Smad pathway.BMC Cancer. 2015 Jun 16;15:469.
REF 96	miR-34a mediates oxaliplatin resistance of colorectal cancer cells by inhibiting macroautophagy via transforming growth factor-/Smad4 pathway.World J Gastroenterol. 2017 Mar 14;23(10):1816-1827.
REF 97	MicroRNA 4a/c function as tumor suppressors in Hep laryngeal carcinoma cells and may reduce GALNT7 expression.Mol Med Rep. 2014 Apr;9(4):1293-8.
REF 98	Oxidative stress dependent microRNA-34a activation via PI3K reduces the expression of sirtuin-1 and sirtuin-6 in epithelial cells. Sci Rep. 2016 Oct 21;6:35871.
REF 99	Sirt7 promotes gastric cancer growth and inhibits apoptosis by epigenetically inhibiting miR-34a.Sci Rep. 2015 Apr 10;5:9787.
REF 100	Role of miR-34a as a suppressor of L1CAM in endometrial carcinoma.Oncotarget. 2014 Jan 30;5(2):462-72.
REF 101	Aptamer-Dendrimer Bioconjugates for Targeted Delivery of miR-34a Expressing Plasmid and Antitumor Effects in Non-Small Cell Lung Cancer Cells. PLoS One. 2015 Sep 25;10(9):e0139136.
REF 102	Shikonin inhibits adipogenic differentiation via regulation ofir-34a-FKBP1B.Biochem Biophys Res Commun. 2015 Nov 27;467(4):941-7.
REF 103	The RNA-binding protein PCBP2 facilitates gastric carcinoma growth by targeting miR-34a.Biochem Biophys Res Commun. 2014 Jun 13;448(4):437-42.
REF 104	OCT4 as a target of miR-34a stimulates p63 but inhibits p53 to promote human cell transformation.Cell Death Dis. 2014 Jan 23;5:e1024.
REF 105	MicroRNA-34a suppresses invasion through downregulation of Notch1 and Jagged1 in cervical carcinoma and choriocarcinoma cells. Carcinogenesis. 2010 Jun;31(6):1037-44.
REF 106	MicroRNA-34a modulates MDM4 expression via a target site in the open reading frame.PLoS One. 2012;7(8):e42034.
REF 107	miR-34a and its novel target, NLRC5, are associated with HPV16 persistence.Infect Genet Evol. 2016 Oct;44:293-299.
REF 108	A miR-34a-Numb Feedforward Loop Triggered by Inflammation Regulates Asymmetric Stem Cell Division in Intestine and Colon Cancer.Cell Stem Cell. 2016 Feb 4;18(2):189-202.
REF 109	Expression of tumor suppressive microRNA-34a is associated with a reduced risk of bladder cancer recurrence.Int J Cancer. 2015 Sep 1;137(5):1158-66.
REF 110	MiR-34a Promotes Osteogenic Differentiation of Human Adipose-Derived Stem Cells via the RBP2/NOTCH1/CYCLIN D1 Coregulatory Network.Stem Cell Reports. 2016 Aug 9;7(2):236-48.
REF 111	Ectopic expression of miR-34a enhances radiosensitivity of non-small cell lung cancer cells, partly by suppressing the LyGDI signaling pathway.J Radiat Res. 2013 Jul 1;54(4):611-9.
REF 112	MicroRNA-34a regulates cardiac ageing and function.Nature. 2013 Mar 7;495(7439):107-10.
REF 113	Micro(mi) RNA-34a targets protein phosphatase (PP)1 to regulate DNA damage tolerance.Cell Cycle. 2015;14(24):3830-41.
REF 114	Neuronal differentiation by TAp73 is mediated by microRNA-34a regulation of synaptic protein targets.Proc Natl Acad Sci U S A. 2011 Dec 27;108(52):21093-8.
REF 115	MicroRNA-34a regulates WNT/TCF7 signaling and inhibits bone metastasis in Ras-activated prostate cancer. Oncotarget. 2015 Jan 1;6(1):441-57.
REF 116	Systematic proteome analysis identifies transcription factor YY1 as a direct target of miR-34a.J Proteome Res. 2011 Feb 4;10(2):479-87.
REF 117	microRNA-34a-Mediated Down-Regulation of the Microglial-Enriched Triggering Receptor and Phagocytosis-Sensor TREM2 in Age-Related Macular Degeneration.PLoS One. 2016 Mar 7;11(3):e0150211.
REF 118	Tumor suppressive microRNAs miR-34a/c control cancer cell expression of ULBP2, a stress-induced ligand of the natural killer cell receptor NKG2D.Cancer Res. 2012 Jan 15;72(2):460-71.
REF 119	miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions.Cell Cycle. 2011 Dec 15;10(24):4256-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.