Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35527 Target Info
Target Name Arachidonate 12-lipoxygenase (12-LOX)
Synonyms Platelet-type lipoxygenase 12; Lipoxin synthase 12-LO; LOG12; Arachidonate 12-lipoxygenase, 12S-type; 12S-lipoxygenase; 12S-LOX; 12LO; 12-lipoxygenase
Target Type Literature-reported Target
Gene Name ALOX12
Biochemical Class Oxygenase
UniProt ID
P18054
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [2]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 Phospho-Np63 regulates AQP3, ALOX12B, CASP14 and CLDN1 expression through transcription and microRNA modulation. FEBS Lett. 2013 Nov 1;587(21):3581-6.
REF 2 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.