Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35799 Target Info
Target Name DNA mismatch repair protein Mlh1 (MLH1)
Synonyms MutL protein homolog 1; COCA2
Target Type Literature-reported Target
Gene Name MLH1
UniProt ID
P40692
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-155 significantly down-regulates hMLH1. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b directly targets the 3'UTR of MLH1 and regulates its expression level. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31-5p directly regulates hMLH1gene expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 MLH1 as a direct target of MiR-155 and a potential predictor of favorable prognosis in pancreatic cancer. J Gastrointest Surg. 2013 Aug;17(8):1399-405.
REF 2 Modulation of mismatch repair and genomic stability by miR-155. Proc Natl Acad Sci U S A. 2010 Apr 13;107(15):6982-7.
REF 3 miRNA-148b regulates radioresistance in non-small lung cancer cells via regulation of MutL homologue 1. Biosci Rep. 2016 Jun 30;36(3). pii: e00354.
REF 4 MicroRNA-31-5p modulates cell cycle by targeting human mutL homolog 1 in human cancer cells. Tumour Biol. 2013 Jun;34(3):1959-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.