Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44458 Target Info
Target Name Cyclin-dependent kinase 9 (CDK9)
Synonyms Tat-associated kinase complex catalytic subunit; TAK; Similar to cyclin-dependent kinase 9; Serine/threonine-protein kinase PITALRE; Cyclin-dependent protein kinase Cdk9; Cell division protein kinase 9; Cell division cycle 2-like protein kinase 4; CDC2L4; CDC2-related kinase; C-2K
Target Type Clinical trial Target
Gene Name CDK9
Biochemical Class Kinase
UniProt ID
P50750
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-874-3p miRNA Info
miRNA Mature AC
MIMAT0004911
Sequence cugcccuggcccgagggaccga
miRNA Species Homo sapiens
Regulation Mechanism miR-874 had an obvious inhibitory effect on the luciferase intensity of wild-type 3' UTR luciferase reporter of CDK9. However, the inhibitory effect of miR-874 was reduced in the presence of mutant 3' UTR luciferase reporter. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 9 (CDK9) Target Info
CDK9_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
miRNA Mature ID hsa-miR-191-5p miRNA Info
miRNA Mature AC
MIMAT0000440
Sequence caacggaaucccaaaagcagcug
miRNA Species Homo sapiens
Regulation Mechanism miR-191 represses proliferation in primary human fibroblasts, multiple proto-oncogenes including CDK9 as novel miR-191 targets, was identified and miR-191 extensively mediates target expression through coding sequence (CDS) pairing. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 MicroRNA-874 inhibits cell proliferation and induces apoptosis in human breast cancer by targeting CDK9. FEBS Lett. 2014 Dec 20;588(24):4527-35.
REF 2 MicroRNA-874 inhibits cell proliferation and invasion by targeting cyclin-dependent kinase 9 in osteosarcoma. Oncol Lett. 2018 May;15(5):7649-7654.
REF 3 MiR-191 Regulates Primary Human Fibroblast Proliferation and Directly Targets Multiple Oncogenes. PLoS One. 2015 May 20;10(5):e0126535.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.