Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T45755 Target Info
Target Name CDK inhibitor 4C p18-INK4c (CDKN2C)
Synonyms P18-INK6; P18-INK4c; P18(INK4c) protein; P18(INK4c); P18 INK4c protein; Cyclin-dependent kinase 6 inhibitor; Cyclin-dependent kinase 4 inhibitor C
Target Type Literature-reported Target
Gene Name CDKN2C
UniProt ID
P42773
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.