Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T46084 |
Target Info
|
| Target Name |
TNF related apoptosis inducing ligand (TNFSF10) |
| Synonyms |
Tumor necrosis factor ligand superfamily member 10; TRAIL; TNF-related apoptosis-inducing ligand; Protein TRAIL; CD253; Apo-2L; Apo-2 ligand; APO2L |
| Target Type |
Clinical trial Target |
| Gene Name |
TNFSF10 |
| Biochemical Class |
Cytokine: tumor necrosis factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-222-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agcuacaucuggcuacugggu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
|
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-221-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agcuacauugucugcuggguuuc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cauugcacuugucucggucuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-25 can target TRAIL. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Altered expression of mir-222 and mir-25 influences diverse gene expression changes in transformed normal and anaplastic thyroidells, and impacts on MEK and TRAIL protein expression. Int J Mol Med. 2016 Aug;38(2):433-45.
|
| REF 2 |
MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
