miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-222-3p
miRNA Stemloop AC MI0000299
miRNA Stemloop ID hsa-mir-222
Sequence agcuacaucuggcuacugggu
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Matrix metalloproteinase-1 (MMP-1) Successful Target Target Info [2]
Tyrosine-protein kinase Kit (KIT) Successful Target Target Info [3]
ATP-binding cassette transporter G2 (ABCG2) Successful Target Target Info [4]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [5]
O-6-methylguanine-DNA-alkyltransferase (MGMT) Clinical trial Target Target Info [6]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [7]
E-selectin (SELE) Clinical trial Target Target Info [5]
Superoxide dismutase Mn (SOD Mn) Clinical trial Target Target Info [8]
TNF related apoptosis inducing ligand (TNFSF10) Clinical trial Target Target Info [9]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [10]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [11]
Bcl-2-binding component 3 (BBC3) Literature-reported Target Target Info [12]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [13]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [14]
Proto-oncogene c-Fos (c-Fos) Literature-reported Target Target Info [15]
AN1-type zinc finger protein 5 (ZFAND5) Literature-reported Target Target Info [16]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [17]
Dickkopf-related protein 2 (DKK2) Literature-reported Target Target Info [18]
CDK inhibitor 1C p57Kip2 (CDKN1C) Literature-reported Target Target Info [19]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [20]
SSX2-interacting protein (SSX2IP) Literature-reported Target Target Info [21]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [22]
Protein(s) Regulated by This miRNA Acyl-protein thioesterase 1 Regulated Protein
LYPA1_HUMAN
[16]
Apoptosis-stimulating of p53 protein 2 Regulated Protein
ASPP2_HUMAN
[16]
AT-rich interactive domain-containing protein 1A Regulated Protein
ARI1A_HUMAN
[24]
Bcl-2-modifying factor Regulated Protein
BMF_HUMAN
[25]
Ceramide synthase 2 Regulated Protein
CERS2_HUMAN
[26]
Coronin-1A Regulated Protein
COR1A_HUMAN
[7]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[28]
Growth factor receptor-bound protein 10 Regulated Protein
GRB10_HUMAN
[29]
GTP-binding protein Di-Ras3 Regulated Protein
DIRA3_HUMAN
[30]
Guanine nucleotide-binding protein G(i) subunit alpha-2 Regulated Protein
GNAI2_HUMAN
[31]
Guanine nucleotide-binding protein G(k) subunit alpha Regulated Protein
GNAI3_HUMAN
[32]
Metalloproteinase inhibitor 3 Regulated Protein
TIMP3_HUMAN
[33]
Mothers against decapentaplegic homolog 5 Regulated Protein
SMAD5_HUMAN
[20]
Multiple epidermal growth factor-like domains protein 9 Regulated Protein
MEGF9_HUMAN
[16]
Phosphatase and actin regulator 4 Regulated Protein
PHAR4_HUMAN
[16]
Plexin-C1 Regulated Protein
PLXC1_HUMAN
[25]
PR domain zinc finger protein 1 Regulated Protein
PRDM1_HUMAN
[35]
Protein FAM214A Regulated Protein
F214A_HUMAN
[16]
Protein mono-ADP-ribosyltransferase TIPARP Regulated Protein
PARPT_HUMAN
[16]
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform Regulated Protein
2ABA_HUMAN
[36]
Sjoegren syndrome/scleroderma autoantigen 1 Regulated Protein
SSA27_HUMAN
[37]
Transcription cofactor vestigial-like protein 4 Regulated Protein
VGLL4_HUMAN
[38]
Transcription elongation factor A protein-like 1 Regulated Protein
TCAL1_HUMAN
[7]
Transmembrane emp24 domain-containing protein 7 Regulated Protein
TMED7_HUMAN
[7]
Type II inositol 3,4-bisphosphate 4-phosphatase Regulated Protein
INP4B_HUMAN
[16]
Uncharacterized protein C18orf25 Regulated Protein
CR025_HUMAN
[16]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[39]
References
REF 1 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2 MicroRNA-222 regulates cell invasion by targeting matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma cell lines. Cancer Genomics Proteomics. 2009 May-Jun;6(3):131-9.
REF 3 MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proc Natl Acad Sci U S A. 2005 Dec 13;102(50):18081-6.
REF 4 Deregulation of the miR-222-ABCG2 regulatory module in tongue squamous cell carcinoma contributes to chemoresistance and enhanced migratory/invasive potential. Oncotarget. 2015 Dec 29;6(42):44538-50.
REF 5 Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 6 MiR-221/222 target the DNA methyltransferase MGMT in glioma cells. PLoS One. 2013 Sep 19;8(9):e74466.
REF 7 miR-221 and miR-222 expression increased the growth and tumorigenesis of oral carcinoma cells. J Oral Pathol Med. 2011 Aug;40(7):560-6.
REF 8 MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35.
REF 9 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55.
REF 10 miR-221/222 is the regulator of Cx43 expression in human glioblastoma cells. Oncol Rep. 2012 May;27(5):1504-10.
REF 11 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 12 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 13 MiR-222 promotes drug-resistance of breast cancer cells to adriamycin via modulation of PTEN/Akt/FOXO1 pathway. Gene. 2017 Jan 5;596:110-118.
REF 14 Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.
REF 15 MicroRNA-34a inhibits cell proliferation by repressing mitogen-activated protein kinase kinase 1 during megakaryocytic differentiation of K562 cells. Mol Pharmacol. 2010 Jun;77(6):1016-24.
REF 16 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 17 miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24.
REF 18 MicroRNA-222 promotes tumorigenesis via targeting DKK2 and activating the Wnt/-catenin signaling pathway. FEBS Lett. 2013 Jun 19;587(12):1742-8.
REF 19 MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res. 2008 Apr 15;68(8):2773-80.
REF 20 Inhibition of miR-222-3p activity promoted osteogenic differentiation of hBMSCs by regulating Smad5-RUNX2 signal axis. Biochem Biophys Res Commun. 2016 Feb 12;470(3):498-503.
REF 21 miR-221/222 targets adiponectin receptor 1 to promote the epithelial-to-mesenchymal transition in breast cancer. PLoS One. 2013 Jun 11;8(6):e66502.
REF 22 miR-221 and miR-222 Simultaneously Target RECK and Regulate Growth and Invasion of Gastric Cancer Cells. Med Sci Monit. 2015 Sep 13;21:2718-25.
REF 23 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 24 Role and mechanism of miR-222 in arsenic-transformed cells for inducing tumor growth.Oncotarget. 2016 Apr 5;7(14):17805-14.
REF 25 Gas5 Exerts Tumor-suppressive Functions in Human Glioma Cells by Targeting miR-222.Mol Ther. 2015 Dec;23(12):1899-911.
REF 26 miR-221 and miR-222 promote Schwann cell proliferation and migration by targeting LASS2 after sciatic nerve injury.J Cell Sci. 2012 Jun 1;125(Pt 11):2675-83.
REF 27 miR-221 and miR-222 expression increased the growth and tumorigenesis of oral carcinoma cells. J Oral Pathol Med. 2011 Aug;40(7):560-6.
REF 28 MicroRNA cluster 221-222 and estrogen receptor alpha interactions in breast cancer. J Natl Cancer Inst. 2010 May 19;102(10):706-21.
REF 29 Interactions of Melanoma Cells with Distal Keratinocytes Trigger Metastasis via Notch Signaling Inhibition of MITF. Mol Cell. 2015 Aug 20;59(4):664-76.
REF 30 MicroRNAs 221/222 and genistein-mediated regulation of ARHI tumor suppressor gene in prostate cancer.Cancer Prev Res (Phila). 2011 Jan;4(1):76-86.
REF 31 MicroRNA-222-3p/GNAI2/AKT axis inhibits epithelial ovarian cancer cell growth and associates with good overall survival.Oncotarget. 2016 Dec 6;7(49):80633-80654.
REF 32 GNAI3 inhibits tumor cell migration and invasion and is post-transcriptionally regulated by miR-222 in hepatocellular carcinoma.Cancer Lett. 2015 Jan 28;356(2 Pt B):978-84.
REF 33 miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell. 2009 Dec 8;16(6):498-509.
REF 34 Inhibition of miR-222-3p activity promoted osteogenic differentiation of hBMSCs by regulating Smad5-RUNX2 signal axis. Biochem Biophys Res Commun. 2016 Feb 12;470(3):498-503.
REF 35 Uncovering MicroRNA Regulatory Hubs that Modulate Plasma Cell Differentiation.Sci Rep. 2015 Dec 11;5:17957.
REF 36 MiR-222 overexpression confers cell migratory advantages in hepatocellular carcinoma through enhancing AKT signaling.Clin Cancer Res. 2010 Feb 1;16(3):867-75.
REF 37 Long Non-coding RNA Growth Arrest-specific Transcript 5 (GAS5) Inhibits Liver Fibrogenesis through a Mechanism of Competing Endogenous RNA.J Biol Chem. 2015 Nov 20;290(47):28286-98.
REF 38 miR-222/VGLL4/YAP-TEAD1 regulatory loop promotes proliferation and invasion of gastric cancer cells. Am J Cancer Res. 2015 Feb 15;5(3):1158-68.
REF 39 TRPS1 targeting by miR-221/222 promotes the epithelial-to-mesenchymal transition in breast cancer.Sci Signal. 2011 Jun 14;4(177):ra41.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.