miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-221-3p
miRNA Stemloop AC MI0000298
miRNA Stemloop ID hsa-mir-221
Sequence agcuacauugucugcuggguuuc
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [2]
Tyrosine-protein kinase Kit (KIT) Successful Target Target Info [3]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [4]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [5]
O-6-methylguanine-DNA-alkyltransferase (MGMT) Clinical trial Target Target Info [6]
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Clinical trial Target Target Info [7]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [7]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [8]
E-selectin (SELE) Clinical trial Target Target Info [4]
TNF related apoptosis inducing ligand (TNFSF10) Clinical trial Target Target Info [9]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [10]
Stromal cell-derived factor 1 (CXCL12) Clinical trial Target Target Info [11]
NF-kappa-B-activating kinase (TBK1) Patented-recorded Target Target Info [12]
TIR domain-containing adapter molecule 1 (TICAM1) Patented-recorded Target Target Info [13]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [14]
PAK-1 protein kinase (PAK1) Literature-reported Target Target Info [15]
Bcl-2-binding component 3 (BBC3) Literature-reported Target Target Info [12]
DNA repair protein RAD51 homolog 1 (RAD51) Clinical trial Target Target Info [16]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [17]
Proto-oncogene c-Fos (c-Fos) Literature-reported Target Target Info [18]
Beclin-1 (BECN1) Literature-reported Target Target Info [19]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [20]
Dickkopf-related protein 2 (DKK2) Literature-reported Target Target Info [12]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [21]
CDK inhibitor 1C p57Kip2 (CDKN1C) Literature-reported Target Target Info [22]
SSX2-interacting protein (SSX2IP) Literature-reported Target Target Info [23]
Stathmin-1 (STMN1) Literature-reported Target Target Info [7]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [24]
Suppressor of cytokine signaling 3 (SOCS3) Literature-reported Target Target Info [24]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [25]
Protein(s) Regulated by This miRNA A disintegrin and metalloproteinase with thrombospondin motifs 6 Regulated Protein
ATS6_HUMAN
[26]
ADP-ribosylation factor 4 Regulated Protein
ARF4_HUMAN
[27]
ADP-ribosylation factor 4 Regulated Protein
ARF4_HUMAN
[28]
Ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1 Regulated Protein
ASZ1_HUMAN
[29]
Annexin A1 Regulated Protein
ANXA1_HUMAN
[30]
Apoptotic protease-activating factor 1 Regulated Protein
APAF_HUMAN
[30]
Aryl hydrocarbon receptor nuclear translocator Regulated Protein
ARNT_HUMAN
[31]
Baculoviral IAP repeat-containing protein 1 Regulated Protein
BIRC1_HUMAN
[32]
Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[33]
Bcl-2-modifying factor Regulated Protein
BMF_HUMAN
[34]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 Regulated Protein
BNIP3_HUMAN
[12]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like Regulated Protein
BNI3L_HUMAN
[12]
Bombesin receptor-activated protein C6orf89 Regulated Protein
CF089_HUMAN
[12]
Ceramide synthase 2 Regulated Protein
CERS2_HUMAN
[36]
Coronin-1A Regulated Protein
COR1A_HUMAN
[8]
CREB/ATF bZIP transcription factor Regulated Protein
ZHANG_HUMAN
[12]
E3 ubiquitin-protein ligase ARIH2 Regulated Protein
ARI2_HUMAN
[12]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[38]
Growth factor receptor-bound protein 10 Regulated Protein
GRB10_HUMAN
[39]
GTP-binding protein Di-Ras3 Regulated Protein
DIRA3_HUMAN
[40]
HMG domain-containing protein 4 Regulated Protein
HMGX4_HUMAN
[12]
Homeobox protein Hox-B5 Regulated Protein
HXB5_HUMAN
[41]
Homeobox protein Hox-C10 Regulated Protein
HXC10_HUMAN
[21]
Homeobox protein MOX-2 Regulated Protein
MEOX2_HUMAN
[21]
Metalloproteinase inhibitor 3 Regulated Protein
TIMP3_HUMAN
[43]
Methyl-CpG-binding domain protein 2 Regulated Protein
MBD2_HUMAN
[44]
Myb-related protein A Regulated Protein
MYBA_HUMAN
[12]
Phosphatidylinositol 3-kinase regulatory subunit alpha Regulated Protein
P85A_HUMAN
[2]
POU domain, class 3, transcription factor 2 Regulated Protein
PO3F2_HUMAN
[21]
Probable E3 ubiquitin-protein ligase HECTD2 Regulated Protein
HECD2_HUMAN
[46]
Ras-related protein Rab-1A Regulated Protein
RAB1A_HUMAN
[46]
Retinoblastoma-associated protein Regulated Protein
RB_HUMAN
[30]
Runt-related transcription factor 1 Regulated Protein
RUNX1_HUMAN
[31]
Segment polarity protein dishevelled homolog DVL-2 Regulated Protein
DVL2_HUMAN
[47]
Synaptic functional regulator FMR1 Regulated Protein
FMR1_HUMAN
[48]
Transcription elongation factor A protein-like 1 Regulated Protein
TCAL1_HUMAN
[8]
Transcriptional repressor CTCF Regulated Protein
CTCF_HUMAN
[30]
Transmembrane emp24 domain-containing protein 7 Regulated Protein
TMED7_HUMAN
[8]
Ubl carboxyl-terminal hydrolase 18 Regulated Protein
UBP18_HUMAN
[12]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[49]
References
REF 1 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623.
REF 3 MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proc Natl Acad Sci U S A. 2005 Dec 13;102(50):18081-6.
REF 4 Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 5 Down-regulation of mir-221 and mir-222 restrain prostate cancer cell proliferation and migration that is partly mediated by activation of SIRT1. PLoS One. 2014 Jun 3;9(6):e98833.
REF 6 MiR-221/222 target the DNA methyltransferase MGMT in glioma cells. PLoS One. 2013 Sep 19;8(9):e74466.
REF 7 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 8 miR-221 and miR-222 expression increased the growth and tumorigenesis of oral carcinoma cells. J Oral Pathol Med. 2011 Aug;40(7):560-6.
REF 9 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55.
REF 10 miR-221/222 is the regulator of Cx43 expression in human glioblastoma cells. Oncol Rep. 2012 May;27(5):1504-10.
REF 11 Downregulation of miR-221-3p contributes to IL-1-induced cartilage degradation by directly targeting the SDF1/CXCR4 signaling pathway. J Mol Med (Berl). 2017 Jun;95(6):615-627.
REF 12 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 13 MicroRNA-221 controls expression of intercellular adhesion molecule-1 in epithelial cells in response to Cryptosporidium parvum infection. Int J Parasitol. 2011 Mar;41(3-4):397-403.
REF 14 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 15 Increased expression of microRNA-221 inhibits PAK1 in endothelial progenitor cells and impairs its function via c-Raf/MEK/ERK pathway. Biochem Biophys Res Commun. 2013 Feb 15;431(3):404-8.
REF 16 Slug/-catenin-dependent proinflammatory phenotype in hypoxic breast cancer stem cells. Am J Pathol. 2013 Nov;183(5):1688-1697.
REF 17 Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.
REF 18 MicroRNA-34a inhibits cell proliferation by repressing mitogen-activated protein kinase kinase 1 during megakaryocytic differentiation of K562 cells. Mol Pharmacol. 2010 Jun;77(6):1016-24.
REF 19 mda-7/IL-24 Mediates Cancer Cell-Specific Death via Regulation of miR-221 and the Beclin-1 Axis. Cancer Res. 2017 Feb 15;77(4):949-959.
REF 20 miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24.
REF 21 Regulation of the expression and activity of the antiangiogenic homeobox gene GAX/MEOX2 by ZEB2 and microRNA-221. Mol Cell Biol. 2010 Aug;30(15):3902-13.
REF 22 MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res. 2008 Apr 15;68(8):2773-80.
REF 23 miR-221/222 targets adiponectin receptor 1 to promote the epithelial-to-mesenchymal transition in breast cancer. PLoS One. 2013 Jun 11;8(6):e66502.
REF 24 MiR-221 accentuates IFNs anti-HCV effect by downregulating SOCS1 and SOCS3. Virology. 2014 Aug;462-463:343-50.
REF 25 MicroRNA-221 promotes colorectal cancer cell invasion and metastasis by targeting RECK. FEBS Lett. 2014 Jan 3;588(1):99-104.
REF 26 ADAMTS6 suppresses tumor progression via the ERK signaling pathway and serves as a prognostic marker in human breast cancer.Oncotarget. 2016 Sep 20;7(38):61273-61283.
REF 27 Prediction of key genes and miRNAs responsible for loss of muscle force in patients during an acute exacerbation of chronic obstructive pulmonary disease.Int J Mol Med. 2016 Nov;38(5):1450-1462.
REF 28 MiR-221-3p targets ARF4 and inhibits the proliferation and migration of epithelial ovarian cancer cells.Biochem Biophys Res Commun. 2018 Mar 18;497(4):1162-1170.
REF 29 Identification of miR-221 and -222 as important regulators in genotype IV swine hepatitis E virus ORF3-expressing HEK 293 cells.Virus Genes. 2013 Aug;47(1):49-55.
REF 30 miR-221 affects multiple cancer pathways by modulating the level of hundreds messenger RNAs. Front Genet. 2013 Apr 25;4:64.
REF 31 Chronic ethanol consumption modulates growth factor release, mucosal cytokine production, and microRNA expression in nonhuman primates.Alcohol Clin Exp Res. 2014 Apr;38(4):980-93.
REF 32 Up-regulation of micro-RNA-221 (miRNA-221; chr Xp11.3) and caspase-3 accompanies down-regulation of the survivin-1 homolog BIRC1 (NAIP) in glioblastoma multiforme (GBM).J Neurooncol. 2009 Jan;91(1):27-32.
REF 33 Knockdown of miR-221 promotes the cisplatin-inducing apoptosis by targeting the BIM-Bax/Bak axis in breast cancer.Tumour Biol. 2016 Apr;37(4):4509-15.
REF 34 MicroRNA-221 targets Bmf in hepatocellular carcinoma and correlates with tumor multifocality.Clin Cancer Res. 2009 Aug 15;15(16):5073-81.
REF 35 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 36 miR-221 and miR-222 promote Schwann cell proliferation and migration by targeting LASS2 after sciatic nerve injury.J Cell Sci. 2012 Jun 1;125(Pt 11):2675-83.
REF 37 miR-221 and miR-222 expression increased the growth and tumorigenesis of oral carcinoma cells. J Oral Pathol Med. 2011 Aug;40(7):560-6.
REF 38 MicroRNA cluster 221-222 and estrogen receptor alpha interactions in breast cancer. J Natl Cancer Inst. 2010 May 19;102(10):706-21.
REF 39 Interactions of Melanoma Cells with Distal Keratinocytes Trigger Metastasis via Notch Signaling Inhibition of MITF. Mol Cell. 2015 Aug 20;59(4):664-76.
REF 40 MicroRNAs 221/222 and genistein-mediated regulation of ARHI tumor suppressor gene in prostate cancer.Cancer Prev Res (Phila). 2011 Jan;4(1):76-86.
REF 41 In vivo imaging of functional targeting of miR-221 in papillary thyroid carcinoma.J Nucl Med. 2008 Oct;49(10):1686-93.
REF 42 Regulation of the expression and activity of the antiangiogenic homeobox gene GAX/MEOX2 by ZEB2 and microRNA-221. Mol Cell Biol. 2010 Aug;30(15):3902-13.
REF 43 miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell. 2009 Dec 8;16(6):498-509.
REF 44 Downregulation of miR-221 Inhibits Cell Migration and Invasion through Targeting Methyl-CpG Binding Domain Protein 2 in Human Oral Squamous Cell Carcinoma Cells.Biomed Res Int. 2015;2015:751672.
REF 45 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623.
REF 46 MiR-221 promotes the development of androgen independence in prostate cancer cells via downregulation of HECTD2 and RAB1A.Oncogene. 2014 May 22;33(21):2790-800.
REF 47 MiR-221 expression affects invasion potential of human prostate carcinoma cell lines by targeting DVL2.Med Oncol. 2012 Jun;29(2):815-22.
REF 48 The 3' UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse.Hum Mol Genet. 2013 May 15;22(10):1971-82.
REF 49 TRPS1 targeting by miR-221/222 promotes the epithelial-to-mesenchymal transition in breast cancer.Sci Signal. 2011 Jun 14;4(177):ra41.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.