Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46482 Target Info
Target Name Toll-like receptor 7 (TLR7)
Synonyms Toll-like receptor 7
Target Type Successful Target
Gene Name TLR7
Biochemical Class Toll-like receptor
UniProt ID
Q9NYK1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assays with NIH-3T3 cells transiently transfected with reporter gene along with miR-17 expression vectors were consistent with regulation of TLR7 by miR-17. Mutation of the binding sites for miR-17 in TLR7 restored luciferase activity. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assays with NIH-3T3 cells transiently transfected with reporter gene along with miR-19a expression vectors were consistent with regulation of TLR7 by miR-19a. Mutation of the binding sites for miR-19a in TLR7 restored luciferase activity. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-758-3p miRNA Info
miRNA Mature AC
MIMAT0003879
Sequence uuugugaccugguccacuaacc
miRNA Species Homo sapiens
Regulation Mechanism miR-758 down-regulated TLR7 expression and that its inhibitor could upregulate TLR7 expression. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Toll-like receptor 3 (TLR3) Target Info
TLR3_HUMAN
References  Top
REF 1 Microenvironmental interleukin-6 suppresses toll-like receptor signaling in human leukemia cells through miR-17/19A. Blood. 2015 Aug 6;126(6):766-78.
REF 2 Sequence-dependent off-target inhibition of TLR7/8 sensing by synthetic microRNA inhibitors. Nucleic Acids Res. 2015 Jan;43(2):1177-88.
REF 3 Hepatitis C virus infection decreases the expression of Toll-like receptors 3 and 7 via upregulation of miR-758. Arch Virol. 2014 Nov;159(11):2997-3003.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.