Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46849 Target Info
Target Name DNA mismatch repair protein MSH2 (MSH2)
Synonyms hMSH2; MutS protein homolog 2; Mismatch repair gene Msh2
Target Type Literature-reported Target
Gene Name MSH2
UniProt ID
P43246
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 which targeted the 3'UTR of MSH2 mRNA and downregulated its expression. [5]
Evidence Score (E-score) 5 +
1 Immunoblot; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Microarray [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-155 significantly down-regulates MSH2. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Northern Blot [6]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-3163 miRNA Info
miRNA Mature AC
MIMAT0015037
Sequence uauaaaaugagggcaguaagac
miRNA Species Homo sapiens
Regulation Mechanism miR-3163 targets and modulates MSH2. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA DNA mismatch repair protein MSH2 (MSH2) Target Info
MSH2_HUMAN
S-phase kinase-associated protein 2 (SKP2) Target Info
SKP2_HUMAN
References  Top
REF 1 A versatile microsatellite instability reporter system in human cells. Nucleic Acids Res. 2013 Sep;41(16):e158.
REF 2 MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2). Proc Natl Acad Sci U S A. 2010 Dec 7;107(49):21098-103.
REF 3 miR-21 induces cell cycle at S phase and modulates cell proliferation by down-regulating hMSH2 in lung cancer. J Cancer Res Clin Oncol. 2012 Oct;138(10):1781-8.
REF 4 Context-dependent bidirectional regulation of the MutS homolog 2 by transforming growth factor contributes to chemoresistance in breast cancer cells. Mol Cancer Res. 2010 Dec;8(12):1633-42.
REF 5 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 6 Modulation of mismatch repair and genomic stability by miR-155. Proc Natl Acad Sci U S A. 2010 Apr 13;107(15):6982-7.
REF 7 Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway. Mol Carcinog. 2017 Apr;56(4):1372-1379.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.