Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T47594 Target Info
Target Name Activin receptor type IB (ACVR1B)
Synonyms Serine/threonine-protein kinase receptor R2; SKR2; Activin receptor-like kinase 4; Activin receptor type-1B; ALK4; ALK-4; ACVRLK4; ACTR-IB
Target Type Patented-recorded Target
Gene Name ACVR1B
Biochemical Class Kinase
UniProt ID
P36896
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism ACVR1B were significantly enriched in immunoprecipitates of miR-210-overexpressing cells. [3]
Evidence Score (E-score) 2 +
1 Immunoprecipitation [3]
2 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-24-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ACVR1B. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
References  Top
REF 1 MiR-135b is a direct PAX6 target and specifies human neuroectoderm by inhibiting TGF-/BMP signaling. EMBO J. 2014 Jun 2;33(11):1271-83.
REF 2 Sulforaphane Induces miR135b-5p and Its Target Gene, RASAL2, thereby Inhibiting the Progression of Pancreatic Cancer. Mol Ther Oncolytics. 2019 Apr 6;14:74-81.
REF 3 An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 4 miR-210 promotes osteoblastic differentiation through inhibition of AcvR1b. FEBS Lett. 2009 Jul 7;583(13):2263-8.
REF 5 MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4. Blood. 2008 Jan 15;111(2):588-95.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.