Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T48330 Target Info
Target Name Large neutral amino acids transporter 1 (SLC7A5)
Synonyms y+ system cationic amino acid transporter; Solute carrier family 7 member 5; MPE16; Large neutral amino acids transporter small subunit 1; LAT1; L-type amino acid transporter LAT1; L-type amino acid transporter 1; Integral membrane protein E16; HLAT1; CD98LC; CD98 light chain; 4F2LC; 4F2 light chain; 4F2 LC
Target Type Literature-reported Target
Gene Name SLC7A5
Biochemical Class Amino acid-polyamine-organocation
UniProt ID
Q01650
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-193-3p significantly reduced luciferase activities when the cells were transfected with the luciferase construct containing the 3'UTR of SCL7A5. [5]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-626 miRNA Info
miRNA Mature AC
MIMAT0003295
Sequence agcugucugaaaaugucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Large neutral amino acids transporter 1 (SLC7A5) Target Info
LAT1_HUMAN
References  Top
REF 1 MicroRNA-126 inhibits cell proliferation in gastric cancer by targeting LAT-1. Biomed Pharmacother. 2015 May;72:66-73.
REF 2 miR-126 inhibits proliferation of small cell lung cancer cells by targeting SLC7A5. FEBS Lett. 2011 Apr 20;585(8):1191-6.
REF 3 miR-126-3p Inhibits Thyroid Cancer Cell Growth and Metastasis, and Is Associated with Aggressive Thyroid Cancer. PLoS One. 2015 Aug 5;10(8):e0130496.
REF 4 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 5 XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057.
REF 6 MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9.
REF 7 MicroRNA-7 modulates CD98 expression during intestinal epithelial cell differentiation. J Biol Chem. 2010 Jan 8;285(2):1479-89.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.