Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T48330 | Target Info | |||
| Target Name | Large neutral amino acids transporter 1 (SLC7A5) | ||||
| Synonyms | y+ system cationic amino acid transporter; Solute carrier family 7 member 5; MPE16; Large neutral amino acids transporter small subunit 1; LAT1; L-type amino acid transporter LAT1; L-type amino acid transporter 1; Integral membrane protein E16; HLAT1; CD98LC; CD98 light chain; 4F2LC; 4F2 light chain; 4F2 LC | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | SLC7A5 | ||||
| Biochemical Class | Amino acid-polyamine-organocation | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-126-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucguaccgugaguaauaaugcg | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [1] | |||
| 2 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
| 3 | Luciferase Reporter Assay; Western Blot | [3] | |||
| 4 | PAR-CLIP | [4] | |||
| Representative Target(s) Regulated by This miRNA | Adrenomedullin (ADM) | Target Info | |||
| Angiopoietin 1 receptor (TEK) | Target Info | ||||
| miRNA Mature ID | hsa-miR-193a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aacuggccuacaaagucccagu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Overexpression of miR-193-3p significantly reduced luciferase activities when the cells were transfected with the luciferase construct containing the 3'UTR of SCL7A5. | [5] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [5] | |||
| Representative Target(s) Regulated by This miRNA | E2F transcription factor 1 (E2F1) | Target Info | |||
| Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-663a | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aggcggggcgccgcgggaccgc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Microarray | [6] | |||
| Representative Target(s) Regulated by This miRNA | C-X-C chemokine receptor type 4 (CXCR4) | Target Info | |||
| CCAAT/enhancer binding protein beta (CEBPB) | Target Info | ||||
| miRNA Mature ID | hsa-miR-626 | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | agcugucugaaaaugucuu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [7] | |||
| Representative Target(s) Regulated by This miRNA | Large neutral amino acids transporter 1 (SLC7A5) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-126 inhibits cell proliferation in gastric cancer by targeting LAT-1. Biomed Pharmacother. 2015 May;72:66-73. | ||||
| REF 2 | miR-126 inhibits proliferation of small cell lung cancer cells by targeting SLC7A5. FEBS Lett. 2011 Apr 20;585(8):1191-6. | ||||
| REF 3 | miR-126-3p Inhibits Thyroid Cancer Cell Growth and Metastasis, and Is Associated with Aggressive Thyroid Cancer. PLoS One. 2015 Aug 5;10(8):e0130496. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057. | ||||
| REF 6 | MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9. | ||||
| REF 7 | MicroRNA-7 modulates CD98 expression during intestinal epithelial cell differentiation. J Biol Chem. 2010 Jan 8;285(2):1479-89. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.